37
views
0
recommends
+1 Recommend
1 collections
    0
    shares
      • Record: found
      • Abstract: found
      • Article: found
      Is Open Access

      Heterozygous Mutations of FREM1 Are Associated with an Increased Risk of Isolated Metopic Craniosynostosis in Humans and Mice

      research-article

      Read this article at

      Bookmark
          There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

          Abstract

          The premature fusion of the paired frontal bones results in metopic craniosynostosis (MC) and gives rise to the clinical phenotype of trigonocephaly. Deletions of chromosome 9p22.3 are well described as a cause of MC with variably penetrant midface hypoplasia. In order to identify the gene responsible for the trigonocephaly component of the 9p22.3 syndrome, a cohort of 109 patients were assessed by high-resolution arrays and MLPA for copy number variations (CNVs) involving 9p22. Five CNVs involving FREM1, all of which were de novo variants, were identified by array-based analyses. The remaining 104 patients with MC were then subjected to targeted FREM1 gene re-sequencing, which identified 3 further mutant alleles, one of which was de novo. Consistent with a pathogenic role, mouse Frem1 mRNA and protein expression was demonstrated in the metopic suture as well as in the pericranium and dura mater. Micro-computed tomography based analyses of the mouse posterior frontal (PF) suture, the human metopic suture equivalent, revealed advanced fusion in all mice homozygous for either of two different Frem1 mutant alleles, while heterozygotes exhibited variably penetrant PF suture anomalies. Gene dosage-related penetrance of midfacial hypoplasia was also evident in the Frem1 mutants. These data suggest that CNVs and mutations involving FREM1 can be identified in a significant percentage of people with MC with or without midface hypoplasia. Furthermore, we present Frem1 mutant mice as the first bona fide mouse model of human metopic craniosynostosis and a new model for midfacial hypoplasia.

          Author Summary

          Although twin and family studies have shown that genes play a critical role in the timing of fusion of skull bones, the identification of specific genes that may be involved has remained somewhat elusive except in the case of the dominantly inherited craniosynostosis syndromes. Metopic craniosynostosis (MC), the early fusion of the forehead (frontal) bones, accounts for 5%–15% of all craniosynostosis cases. This premature fusion of the frontal bones results in a characteristically altered skull shape, termed trigonocephaly, that usually requires surgical correction. Remarkably, the cause of the majority of cases of MC remains unknown (idiopathic). Here, we report genetic variants involving chromosome 9 which involve and interrupt the structure of the FREM1 gene in a large cohort of patients presenting with unisutural metopic craniosynostosis. Micro-computed tomographic (microCT) imaging and quantitative analysis of skull shape reveal both premature fusion of the PF suture (metopic equivalent) and also changes in frontal bone shape supportive of a role for Frem1 in regulation of the metopic suture. Taken together with Frem1 gene and protein expression findings, these data indicate that mutations in FREM1 can give rise to metopic craniosynostosis.

          Related collections

          Most cited references32

          • Record: found
          • Abstract: found
          • Article: not found

          RET tyrosine kinase signaling in development and cancer.

          The variety of diseases caused by mutations in RET receptor tyrosine kinase provides a classic example of phenotypic heterogeneity. Gain-of-function mutations of RET are associated with human cancer. Gene rearrangements juxtaposing the tyrosine kinase domain to heterologous gene partners have been found in sporadic papillary carcinomas of the thyroid (PTC). These rearrangements generate chimeric RET/PTC oncogenes. In the germline, point mutations of RET are responsible for multiple endocrine neoplasia type 2 (MEN 2A and 2B) and familial medullary thyroid carcinoma (FMTC). Both MEN 2 mutations and PTC gene rearrangements potentiate the intrinsic tyrosine kinase activity of RET and, ultimately, activate the RET downstream targets. Loss-of-function mutations of RET cause Hirschsprung's disease (HSCR) or colonic aganglionosis. A deeper understanding of the molecular signaling of normal versus abnormal RET activity in cancer will enable the development of potential new treatments for patients with sporadic and inherited thyroid cancer or MEN 2 syndrome. We now review the role and mechanisms of RET signaling in development and carcinogenesis.
            Bookmark
            • Record: found
            • Abstract: found
            • Article: found
            Is Open Access

            Maternal Ethanol Consumption Alters the Epigenotype and the Phenotype of Offspring in a Mouse Model

            Introduction While it is well-recognized that gestational exposure to environmental triggers can lead to compromised fetal development and adult disease in humans [1], the underlying molecular mechanisms remain unknown. There is increasing evidence in animal models that environmental factors can affect gene expression via epigenetic modifications such as DNA methylation [2]–[6]. One way of detecting such events is to use reporters whose expression is closely linked to their epigenetic state. Such epigenetically sensitive alleles are also known as metastable epialleles, and the best known example in the mouse is Agouti viable yellow (MGI:1855930) or Avy [7]. Avy is a dominant mutation of the murine Agouti (A) locus, caused by the insertion of an intracisternal A-particle (IAP) retrotransposon upstream of the Agouti coding exons. The activity of Avy is variable among genetically identical mice, resulting in mice with a range of coat colors; from yellow to mottled to agouti (termed pseudoagouti) [8]. The expression of Avy is known to correlate with DNA methylation at a cryptic long terminal repeat (LTR) promoter located at the 3′ end of the inserted IAP. Specifically, hypomethylation is associated with constitutive ectopic Agouti expression and a yellow coat, while hypermethylation correlates with cryptic promoter silencing and a pseudoagouti coat [9]. We have previously shown that DNA methylation at Avy is reprogrammed in early development at the same time that the rest of the genome is undergoing epigenetic reprogramming [10]. Alcohol consumption is widespread in our society, but it is also recognized as the leading preventable cause of birth defects and mental retardation [11],[12]. High levels of alcohol consumption during pregnancy can result in fetal alcohol syndrome (FAS) which is characterized by prenatal and postnatal growth restriction, craniofacial dysmorphology and structural abnormalities of the central nervous system. The clinical features of FAS are variable and include a range of other birth defects, as well as educational and behavioral problems [13]. This syndrome is the most extreme form of a range of disorders that are known as fetal alcohol spectrum disorders (FASDs) [14]. Approximately 5% of the children of mothers who have drunk heavily during pregnancy have FAS [15], and studies have shown that the dose, time and duration of ethanol exposure are critical [16],[17]. There are a number of mouse models of FAS that have reproduced some of the phenotypic characteristics of the human disorder, particularly the craniofacial abnormalities [16],[18],[19]. It should be noted that these studies used acute ethanol exposures between gestational days (GDs) 7 and 9 and high concentrations; generally two intraperitoneal injections of 0.015 ml of ∼25% (v/v) ethanol per gram of body weight over a 4 hour interval resulting in ataxia and lethargy. These studies only examined the fetal outcomes (GDs 8-18) of ethanol exposure and did not assay offspring either after birth or as adults. There are some rodent studies of the effects of gestational exposure to moderate amounts of ethanol, but these have only identified neurological and behavioral deficits [20]. The molecular mechanisms underlying FAS are unknown. Some studies have focused on the toxic effects of acetaldehyde, the first metabolite of ethanol [18],[21]. Acute ethanol exposure has also been found to result in increased cell death in the developing central nervous system and neurological anomalies in rodents and other animal models [22],[23]. The idea that epigenetic changes are involved has been raised but evidence in support of this hypothesis has, so far, been weak. Garro and colleagues [24] detected a small decrease in the level of global methylation of fetal DNA after acute ethanol administration from GDs 9-11. Bielawski et al. [25] reported decreased DNA methyltransferase 1 (Dnmt1) messenger RNA levels in rat sperm after nine weeks of paternal ethanol exposure. Haycock and Ramsey [26] studied imprinting of the H19/Igf2 in preimplantation mouse embryos after maternal ethanol exposure. Despite severe growth retardation of embryos, they did not find epigenetic changes at the H19 imprinting control region. Here we have developed a mouse model of chronic ethanol exposure (overt signs of intoxication are not observed) that produces measurable phenotypes in adults. We find that maternal ethanol consumption either before or after fertilization affects the expression of an epigenetically sensitive allele, Avy , in her offspring and that, at least in the latter case, can also impact postnatal body weight and skull size and shape in a manner consistent with FASD. Our work raises the possibility of a role for epigenetic reprogramming in the etiology of FASD and provides researchers with a relevant mouse model of the human disorder. Results In this study, Avy was used primarily as a sensitive reporter of epigenetic changes in response to maternal ethanol consumption. The C57BL/6J mouse is null (a) at the Agouti locus, so it has a black coat color. Avy is a gain-of-function, semi-dominant mutation and so the coat color of heterozygous (Avy/a) mice in the C57BL/6J background is a direct read out of Avy transcriptional activity and DNA methylation. The nature of the matings used in this study, an Avy/a male crossed with an a/a female, means that only 50% of the offspring will inherit the Avy allele and be useful for coat color phenotyping. The remaining (a/a) offspring will be black. To study the effects of gestational ethanol exposure, female a/a C57BL/6J mice were supplied with 10% (v/v) ethanol in their drink bottles for eight days after fertilization by a congenic male carrying the Avy allele (n = 46 litters, 242 total offspring, 109 Avy/a offspring). To evaluate the effects of preconceptional ethanol exposure, female a/a mice were given 10% (v/v) ethanol for four days per week for ten weeks prior to fertilization (n = 22 litters, 131 total offspring, 69 Avy/a offspring). The Avy allele was passed through the male germ line to avoid the bias associated with maternal transmission, where epigenetic marks can be incompletely cleared between generations [9]. Control mice were given water instead of ethanol (n = 37 litters, 189 total offspring, 91 Avy/a offspring). Maternal ethanol exposure during gestation did not significantly alter Mendelian inheritance of the Avy allele (data not shown) or litter size (control 5.1±0.4, ethanol exposed 5.2±0.3, mean±SEM, Student's t-test, p = 0.9). The establishment of epigenetic marks at Avy occurs during early embryogenesis and is a probabilistic event. The resulting variable expression of Avy among genetically identical mice produces individuals with a predictable range of coat colors. We found that, in the absence of any treatment, 21% of the offspring of Avy/a sires were yellow, 66% were mottled and 13% were pseudoagouti (Figure 1). Gestational ethanol exposure resulted in a higher proportion of pseudoagouti (Pearson's chi-square test, p 95% yellow), yellow/mottled (75–95% yellow), mottled (25–74% yellow or 25–74% agouti), pseudoagouti/mottled (75–95% agouti) or pseudoagouti (>95% agouti). In the final analysis these categories were combined into three classes: yellow, mottled (comprised of yellow/mottled, mottled and pseudoagouti/mottled) and pseudoagouti. Bisulfite Sequencing For bisulfite sequencing of the Avy allele, 200–400 ng of tail genomic DNA was embedded in agarose and then treated with sodium bisulfite as described previously [10]. The bisulfite-treated DNA was resuspended in 30 µl of water and 5 µl was used in the primary PCR followed by a semi-nested PCR with 2–5 µl of template (primers were forward 5′ gaaaagagagtaagaagtaagagagagag 3′, reverse 5′ aaaatttaacacataccttctaaaaccccc 3′ and semi-nested reverse 5′ actccctcttctaaaactacaaaaactc 3′) [10]. One bisulfite conversion and PCR was performed for each pseudoagouti sample, while 3–5 independent conversions and 3 PCRs/conversion were performed for each yellow sample. Global IAP LTR sequences were amplified from bisulfite-converted tail and forebrain DNA using universal IAP primers; forward 5′ ttgatagttgtgttttaagtggtaaataaa 3′ and reverse 5′ aaaacaccacaaaccaaaatcttctac 3′ [67]. An agarose-only (no template) control was always included and the experiment was only continued if the agarose control was negative at the end of the semi-nested PCR. PCR fragments were gel-isolated and subcloned into the pGEM-T vector (Promega, Madison, Wisconsin, United States). Individually sequenced clones were analyzed with BiQ Analyzer [68]. To avoid bias, clones from the same PCR were only accepted if they differed by either CpG or non-CpG methylation. Any clones with lower than 90% conversion rate were also excluded from the dataset. Gene Expression Arrays To detect possible changes in gene expression in gestational ethanol exposure mice compared to the controls, we used the MouseWG-6 v2.0 Expression BeadChips (Illumina). We extracted total liver RNA from 28 days old males from control and gestational ethanol groups, using a Qiagen RNeasy Plus-kit (Qiagen). We used a Bioanalyzer (Agilent RNA 6000 Nano, Agilent) to confirm the quality of RNA and accepted only samples with RNA Integrity Numbers (RINs) above 9. We amplified RNA using an Illumina TotalPrep RNA Amplification Kit and performed a Whole-Genome Gene Expression Direct Hybridization Assay (Illumina). The gene expression data from scanned microarray images generated by the Illumina BeadArrayTM Reader was analysed by the GenomeStudio Gene Expression Module (Illumina) by using probe information. Four control samples from two litters and three gestational ethanol exposure samples from three litters were analysed. Analysis of Skull Morphology Seventeen a/a mice (ten controls and seven ethanol exposed mice) aged between 28 and 30 days were subjected to micro-computed tomography using a SkyScan 1076 microtomograph at the Small Animal Tomographic Analysis Facility located at the University of Washington. The sex and treatment breakdown of the microCT samples is female ethanol (n = 4), female control (n = 5), male ethanol (n = 3) and male control (n = 5). Specimens were scanned at 18 micron resolution (65 kV, 150 mA, 1.0 mm Al filter) and reconstructed as series of 8-bit grayscale images. Three-dimensional models of the skulls were generated using the thresholding algorithm in Analyze 3D (Mayo Clinic, version 9.0). A grayscale value of 55 was determined to be the optimum threshold value to remove the soft tissue structures and scan noise while keeping the skull morphology intact, and was used for all specimens. Using the point measurement tool of Analyze, 35 landmarks were collected from each specimen (Text S1 and Figure S3). Specimens were digitized by the same observer (MM) to reduce inter-observer error. Visualizations showed that landmark 31 could not be accurately determined in every specimen because of the occasional fusion of the presphenoid and basisphenoid bones. Because geometric morphometrics requires homologous landmarks collected from every specimen, this landmark was omitted in subsequent analyses. Landmark data were fed into various morphometric packages. Using the R statistical package [69], linear measurements of certain common cranial dimensions were calculated from the landmark coordinates and normalized to their respective skull centroid sizes. Generalized Procrustes Analysis (GPA) was also conducted in R by using the SHAPES module. Goodall's F test was used to test for statistical significance of mean shape differences among groups. The Canonical Variates Analysis (CVA) was conducted in the MorphoJ package [70]. The loadings of the canonical variates 1 and 2 were used to visualize the cranial shape changes depicted by each axis. The WinEDMA package [71] was used to conduct Euclidean Distance Matrix Analysis. We used the FORM procedure of WinEDMA to find the landmark pairs that significantly differed between two mean forms (i.e., ethanols and controls) as measured by the form difference matrix. Following Lele and Richtsmeier [45], the 90% confidence intervals for the pairwise ratios were calculated by bootstrapping the form difference matrix 1000 times. Supporting Information Figure S1 Avy methylation in control offspring and offspring exposed to ethanol in utero in mottled mice. Only mice with 50% yellow/50% pseudoagouti coats were assayed. (1.01 MB TIF) Click here for additional data file. Figure S2 Global IAP methylation in control offspring and in offspring exposed to ethanol in utero. Methylation was analyzed by sequencing individual clones of PCR-amplified, bisulfite-converted forebrain and tail genomic DNA. (0.98 MB TIF) Click here for additional data file. Figure S3 Landmark positions. (9.62 MB TIF) Click here for additional data file. Table S1 Summary of significantly up- and down-regulated genes in liver following ethanol exposure in utero. The Diff Score is a transformation of the p-value that provides directionality to the p-value based on the difference between the average signal in the control group versus the ethanol exposed group. For p-values of 0.05, 0.01 and 0.001 the Diff Scores are ±13, ±20, and ±30, respectively. (0.03 MB XLS) Click here for additional data file. Text S1 Landmark descriptions. (0.03 MB DOC) Click here for additional data file.
              Bookmark
              • Record: found
              • Abstract: found
              • Article: not found

              The transcription factor gene Nfib is essential for both lung maturation and brain development.

              The phylogenetically conserved nuclear factor I (NFI) gene family encodes site-specific transcription factors essential for the development of a number of organ systems. We showed previously that Nfia-deficient mice exhibit agenesis of the corpus callosum and other forebrain defects, whereas Nfic-deficient mice have agenesis of molar tooth roots and severe incisor defects. Here we show that Nfib-deficient mice possess unique defects in lung maturation and exhibit callosal agenesis and forebrain defects that are similar to, but more severe than, those seen in Nfia-deficient animals. In addition, loss of Nfib results in defects in basilar pons formation and hippocampus development that are not seen in Nfia-deficient mice. Heterozygous Nfib-deficient animals also exhibit callosal agenesis and delayed lung maturation, indicating haploinsufficiency at the Nfib locus. The similarity in brain defects in Nfia- and Nfib-deficient animals suggests that these two genes may cooperate in late fetal forebrain development, while Nfib is essential for late fetal lung maturation and development of the pons.
                Bookmark

                Author and article information

                Contributors
                Role: Editor
                Journal
                PLoS Genet
                plos
                plosgen
                PLoS Genetics
                Public Library of Science (San Francisco, USA )
                1553-7390
                1553-7404
                September 2011
                September 2011
                8 September 2011
                : 7
                : 9
                : e1002278
                Affiliations
                [1 ]Department of Human Genetics, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands
                [2 ]Division of Craniofacial Medicine, Department of Pediatrics, University of Washington, Seattle, Washington, United States of America
                [3 ]Department of Anatomy and Developmental Biology, Monash University, Clayton, Australia
                [4 ]Department of Biochemistry and Molecular Biology, Monash University, Clayton, Australia
                [5 ]Centro de Estudos do Genoma Humano, Instituto de Biociências, Universidade de São Paulo, São Paulo, Brasil
                [6 ]Section of Genetics, Department of Pediatrics, University of California Davis, Sacramento, California, United States of America
                [7 ]Institute for Protein Research, Osaka University, Osaka, Japan
                [8 ]Donders Institute for Brain, Imaging, and Cognition, Nijmegen, The Netherlands
                [9 ]Australian Craniofacial Unit, Women and Children's Hospital, Adelaide, Australia
                [10 ]Department of Haematology and Genetics, South-Eastern Area Laboratory Services, Prince of Wales and Sydney Children's Hospitals, Randwick, Australia
                [11 ]Sydney South West Genetic Service, Royal Prince Alfred Hospital, Sydney University, Sydney, Australia
                Medical Research Council Human Genetics Unit, United Kingdom
                Author notes

                Conceived and designed the experiments: TR MFB JAV TCC IS SAB MLC LELMV. Performed the experiments: LELMV AMM IMJ KS FW JL GY. Analyzed the data: TR MFB TCC IS HvB. Contributed reagents/materials/analysis tools: FJ DB MRP-B MLC SAB CM PJA KMS DK. Wrote the paper: TR LELMV MFB TCC IS.

                Article
                10-PLGE-RA-3547
                10.1371/journal.pgen.1002278
                3169541
                21931569
                9a71461d-9729-49da-ac32-ac61686a2208
                Vissers et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
                History
                : 2 July 2010
                : 24 July 2011
                Page count
                Pages: 11
                Categories
                Research Article
                Biology
                Genetics
                Genetic Mutation
                Genetics of Disease
                Human Genetics
                Medicine
                Clinical Genetics

                Genetics
                Genetics

                Comments

                Comment on this article