- Record: found
- Abstract: found
- Article: found
Seroconversion to HCoV-NL63 in Rhesus Macaques
research-article
Author(s):
Ronald Dijkman
1 ,
H. Lie Mulder
1 ,
Lynne Rumping
1 ,
Ilse Kraaijvanger
1 ,
Martin Deijs
1 ,
Maarten F. Jebbink
1 ,
Ernst J. Verschoor
2 ,
Lia van der Hoek
1
,
*
Publication date (Electronic):
30 October 2009
Journal:
Viruses
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
Abstract
HCoV-NL63 is a recently identified respiratory virus. Its pathogenesis has not been fully unraveled because an animal model is currently lacking. Here we examined whether rhesus macaques encounter HCoV-NL63 infections during life, by examining the levels of antibodies to HCoV-NL63 in time. The animals were followed for 7 up till 19 years, and in three animals we observed a steep rise in antibodies during follow up, indicative of a natural infection with HCoV-NL63.
Related collections
Most cited references15
- Record: found
- Abstract: found
- Article: not found
Human Coronavirus NL63 Infection and Other Coronavirus Infections in Children Hospitalized with Acute Respiratory Disease in Hong Kong, China
Susan Chiu, Kwok Hung Chan, Ka Wing Chu … (2005)
Abstract Background. Human coronavirus NL63 (HCoV-NL63) is a recently discovered human coronavirus found to cause respiratory illness in children and adults that is distinct from the severe acute respiratory syndrome (SARS) coronavirus and human coronaviruses 229E (HCoV-229E) and OC43 (HCoV-OC43). Methods. We investigated the role that HCoV-NL63, HCoV-OC43, and HCoV-229E played in children hospitalized with fever and acute respiratory symptoms in Hong Kong during the period from August 2001 through August 2002. Results. Coronavirus infections were detected in 26 (4.4%) of 587 children studied; 15 (2.6%) were positive for HCoV-NL63, 9 (1.5%) were positive for HCoV-OC43, and 2 (0.3%) were positive for HCoV-229E. In addition to causing upper respiratory disease, we found that HCoV-NL63 can present as croup, asthma exacerbation, febrile seizures, and high fever. The mean age (± standard deviation [SD]) of the infected children was 30.7 ± 19.8 months (range, 6–57 months). The mean maximum temperature (±SD) for the 12 children who were febrile was 39.3°C ± 0.9°C, and the mean total duration of fever (±SD) for all children was 2.6 ± 1.2 days (range, 1–5 days). HCoV-NL63 infections were noted in the spring and summer months of 2002, whereas HCoV-OC43 infection mainly occurred in the fall and winter months of 2001. HCoV-NL63 viruses appeared to cluster into 2 evolutionary lineages, and viruses from both lineages cocirculated in the same season. Conclusions. HCoV-NL63 is a significant pathogen that contributes to the hospitalization of children, and it was estimated to have caused 224 hospital admissions per 100,000 population aged ⩽6 years each year in Hong Kong.
- Record: found
- Abstract: found
- Article: not found
Croup Is Associated with the Novel Coronavirus NL63
Lia van der Hoek, Klaus Sure, Gabriele Ihorst … (2005)
Introduction Respiratory tract infections are among the most frequent diseases in the first years of life. Although there is a large number of viruses that are known to be involved in symptomatic respiratory tract infections, including respiratory syncytial virus (RSV), influenza virus (INF), parainfluenza virus (PIV), and human metapneumovirus, none of the known pathogens is detected in a substantial number of cases. Recently we identified a novel coronavirus in a child with bronchiolitis: human coronavirus NL63 (HCoV-NL63) [1,2]. This virus, together with SARS-CoV, is one of the new members of the Coronaviridae family [3–6]. Screening of respiratory samples in Amsterdam and Rotterdam confirmed that HCoV-NL63 is circulating among humans with respiratory disease in the Netherlands [1,7]. To investigate the prevalence of HCoV-NL63 and its involvement in respiratory diseases, we now analysed 949 samples from the Paediatric Respiratory Infection in Germany (PRI.DE) study, a prospective population-based study on lower respiratory tract infections (LRTIs) in children under 3 y of age in Germany [8,9]. The PRI.DE study represents the German population by (i) including multicentre sampling (one city each in the north, east, south, and west of the country) and by (ii) recruiting children in paediatric practices and in referral children's hospitals. We were particularly interested in the presence of HCoV-NL63 in respiratory disease for which no other viral pathogen could be detected, in order to identify clinical symptoms associated with HCoV-NL63 infection. Nasopharyngeal secretion (NPS) of the patients had already been tested for RSV, INF, and PIV, the principal viruses responsible for LRTI in young children [8]. However, RNA of these viruses could not be detected in 58% of samples for outpatients and 51% of samples for hospitalised patients. A second study that examined a subset of these negative samples for human metapneumovirus RNA showed that this virus could be detected in only 0.3% of the patients [9]. To explore the potential contribution of HCoV-NL63 to LRTI and to define clinical symptoms associated with HCoV-NL63 infection, a subset of the PRI.DE samples were analysed in this study by a HCoV-NL63-specific quantitative real-time RT-PCR. Methods Participants and Materials The PRI.DE study is a population-based prospective German multicentre study. Patients from Hamburg, Bochum, Freiburg, and Dresden are been included from paediatric practices (outpatients) or hospitals (inpatients) [8]. Children were recruited from November 1999 to October 2001 and included in the study if they showed clinical signs of laryngotracheitis (croup), bronchitis, bronchiolitis, pneumonia, or apnoea, the last only in infants less than 6 mo of age. Signs and symptoms of clinical diagnoses were defined according to criteria of Denny and Clyde [10]. The definition of croup in the inclusion criteria was hoarseness of voice, barking cough, and inspiratory stridor due to laryngeal obstruction. Before the start of the study this definition had been consented to by the heads of the participating hospitals and had been communicated in writing (study protocol) as well as verbally (investigators meetings in the different cities) to the participating physicians. NPS was taken in a standardised manner by introducing a wetted catheter through the lower nasal meatus into the epipharynx and retracting it with a suction of 200 Pa. Liquid nitrogen freezers had been situated at every practice/hospital to snap freeze the specimen immediately after collection. The samples were transported to the central testing laboratory on dry ice. RNA was extracted from 220 μl of NPS using the Qiamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) and eluted in 50 μl of preheated RNase free water (80 °C) for 5 min. The Hexaplex PCR test kit (Prodesse, Milwaukee, Wisconsin, United States) was used to test for the presence of genomic material of seven respiratory viruses: RSV-A, RSV-B, PIV1, PIV2, PIV3, INF A, and INF B [8,11]. The remaining RNA was stored in a −70 °C freezer. Of the total of 3,654 NPSs that were collected within the PRI.DE study, half were randomly assigned to this study. Randomisation was performed via a program generating random numbers in order to distribute the samples equally between two different laboratories. Randomisation was performed separately for each study centre. A subgroup of 949 samples, for which sufficient amounts of RNA were available, were tested for HCoV-NL63 RNA without knowledge of the result of the Hexaplex assay. For a number of important parameters the 949 samples were a proper representation of the complete PRI.DE study (shown in Table 1). Samples from all seasons were roughly equally represented (20.0% of all samples were collected in the winter months December/January/February, 32.9% of all samples were from March/April/May, 38.9% of all samples were from June/July/August, and 28.0 % of all samples were collected in September/October/November). The only period from which only a few samples were analysed was December 1999 to March 2000 (see Figure 1). The study protocol was approved by the Ethics Committee of the University Hospital Freiburg, and by the ethics committee of each participating centre. Written informed consent was obtained from the parents of all participants. Laboratory Testing For real-time HCoV-NL63 PCR, the primers repSZ-1 (5′- GTGATGCATATGCTAATTTG) and repSZ-3 (5′- CTCTTGCAGGTATAATCCTA) [1] were used with a commercially available RT-PCR kit (QuantiTect Probe RT-PCR Kit with separate addition of SYBR Green, Qiagen, Hilden, Germany). RNA (5 μl) was reverse-transcribed in a final volume of 20 μl for 20 min at 50 °C followed by denaturation at 95 °C for 15 min. Forty-nine cycles of PCR amplification were performed in a Rotor-Gene 3000 (Corbett-Research, Mortlake, Australia) at 95 °C for 10 s, followed by an annealing step for 1 min at 55 °C. Elongation was performed at 72 °C for 30 s. Accumulation of PCR products was monitored by measuring fluorescence of intercalated SYBR Green at 72 °C and 81 °C for 15 s. The specificity of the PCR products of samples showing a relevant increase in SYBR Green fluorescence was confirmed by melting point analysis (peak at approximately 86 °C), by determining the size of the PCR product (237 bp) through agarose gel electrophoresis, and by hybridisation to an HCoV-NL63-specific internal probe (5′- AGGGTCCTCCTGGTAGTGGTAAGTCACATTGTTCC). In addition, 17 of the positive PCR products were sequenced to further confirm the identity of the PCR product. Standard precautions were taken to prevent PCR cross-contamination during specimen extraction and PCR amplification. Negative controls included in each run did not show a relevant increase of SYBR Green intercalation. For quantitative evaluation, a PCR product of HCoV-NL63 was cloned in plasmid TOPO PCR II using the TA-cloning kit of Invitrogen (Carlsbad, California, United States). RNA was in vitro transcribed using the AmpliScribe T7 High Yield Transcription Kit (Epicentre Technologies, Madison, Wisconsin, United States) following the manufacturer's instructions. The synthesised RNA was analysed by agarose gel electrophoresis for intactness of the transcript, and the concentration was determined by the Ribo-Green method. Two independently transcribed RNA samples were adjusted to 109 copies/ml, and RT-PCR analysis of serial dilutions of both control RNAs revealed that five RNA copies per reaction could be detected. This corresponds to a detection limit of ≤225 copies/ml NPS. Both in vitro transcribed control RNAs were also used to quantify the RNA copy number in the supernatant of a HCoV-NL63-infected culture. Serial dilutions of the RNA preparation from the virus culture were used as standards in each run of the real-time RT-PCR. The inter-assay variability of the crossing points of RT-PCR samples containing between 260 and 260,000 copies was below 2%, and the inter-assay variability of their copy numbers was below 35%. Since 260 RNA copies per RT-PCR reaction corresponds to a viral load of approximately 104 RNA copies/ml NPS, 104 copies/ml was taken as the lower limit for accurate quantification. Statistical Methods Calculations were performed using the SAS system, version 8.2 (SAS Institute, Cary, North Carolina, United States). Proportions were compared using the χ2 test, and comparisons of viral load were performed by means of Wilcoxon's two-sample test. To determine the association of the investigated viruses with disease (croup or not), odds ratios and corresponding 95% confidence intervals were derived in separate bivariate calculations first. The odds ratios present the probability of croup in children infected with HCoV-NL63 in relation to the probability of croup in patients not infected with HCoV-NL63 within this population of patients with LRTI. Results were confirmed by performing a logistic regression with occurrence of croup as the dependent variable, and detection of RSV, PIV, or HCoV-NL63 as independent variables. Double infections were thus accounted for. INF could not be considered in the model, because no INF-positive croup patients were found. Results HCoV-NL63 Infections Of the 949 PRI.DE samples tested, 392 were from outpatients at the four study sites, and the remaining 557 samples were from hospitalised patients. In total, 49 of the 949 samples (5.2%) were positive for HCoV-NL63. More HCoV-NL63 infections were found in the outpatients (31 patients, 7.9%) than in hospitalised patients (18 patients, 3.2%, p = 0.003). Various clinical diagnoses of lower respiratory tract disease were given for the HCoV-NL63-positive patients, including croup, bronchitis, bronchiolitis, and pneumonia (Table 2). The ages of the HCoV-NL63-infected children ranged from 0 to 2.9 y, with a median age of 0.7 y for the hospitalised patients and 1.5 y for the outpatients. As may be expected based on knowledge of other human coronaviruses, there is a strong seasonal distribution of HCoV-NL63, with preferential detection in the period between November and March (Figure 1). Peaks were observed in December 2000 (14% of patients positive) and February 2001 (12% of patients positive). We found no positive samples in the winter months of 1999 and 2000, but the analysed PRI.DE samples were unequally distributed and only 17 samples were analysed from the period December 1999 to March 2000. HCoV-NL63 Co-Infections with RSV-A and PIV3 Since the same samples had been tested previously for the presence of RSV, PIV, and INF RNA [8], the HCoV-NL63-positive samples were analysed for co-infections with these viruses. Co-infections were apparent in 29 of the 49 HCoV-NL63-positive samples: 20 patients were co-infected with RSV-A, four with RSV-B, and five with PIV3. Double infections were observed in the hospitalised patients with HCoV-NL63 (72%) but also in the outpatients (52%). HCoV-NL63 co-infection with RSV-A occurred predominantly in the hospitalised patients (61%) rather than the outpatient group (29%). In contrast, HCoV-NL63 co-infections with PIV3 were exclusively present in the outpatient group (16%). Similar trends were also observed when looking at the overall prevalence of the viruses: RSV-A occurred in 32% of hospitalised patients versus 21% of outpatients, and PIV3 occurred in 5% of hospitalised patients and 8% of outpatients [8]. The RNA load of HCoV-NL63 differed considerably from less than 225 copies/ml (but detectable) to 9 × 107 copies/ml aspirate. Interestingly, the HCoV-NL63 load was significantly higher in samples with undetectable levels of the other viral RNAs (median viral load 2.1 × 106 copies/ml) than in samples that had co-infections with RSV or PIV3 (2.7 × 102 copies/ml, p = 0.0006; Figure 2). The HCoV-NL63 Load as a Function of Time after Infection As mentioned above, the HCoV-NL63 load in the singly infected group (n = 20) was on average high, although there were a few samples with a load below 10,000 copies/ml (n = 6). The HCoV-NL63 load may be related to the date of sampling relative to the onset of disease. We therefore compared the viral load of these patients with the number of days after the onset of disease that the sample was taken. For the group with a high viral load (>10,000 copies/ml), the median time of sampling after onset of disease was 2 d, whereas the median interval was 6 d for the group with the lower viral load. However, the variation in number of days from onset of disease to sampling was high, and the difference between the high and low viral load group was not statistically significant (p = 0.11). Association of HCoV-NL63 Infection with Clinical Symptoms The high frequency of co-infections in HCoV-NL63-positive samples makes it difficult to define HCoV-NL63-induced symptoms. However, in 20 of the 49 HCoV-NL63-positive samples no other virus (RSV, PIV, or INF) could be detected. At least 14 of these samples also had a high viral RNA load (>10,000 copies/ml aspirate), cases that may be best suited to study the clinical symptoms associated with HCoV-NL63 infection. Six of the 14 children (43%) of this group had croup compared to only 54 of 900 HCoV-NL63-negative children (6%, p < 0.0001). A similar high frequency of croup (45%) was also observed for the 20 samples in which only HCoV-NL63 RNA was detected, independent of the viral load. The association of HCoV-NL63 with croup also held for all analysed samples: 24% in the HCoV-NL63-positive group had croup compared to 6% of the 900 HCoV-NL63-negative patients (p < 0.0001). HCoV-NL63 was detectable in 17.4% of all samples from croup patients. The chance of croup is estimated to be 6.6 times higher in HCoV-NL63-positive LRTI patients than in HCoV-NL63-negative LRTI patients (95% confidence interval 3.1–14.2), similar to that found for PIV1, PIV2, and PIV3 (Table 3). In addition to croup, we also observed bronchitis (n = 6, of which one also had croup), bronchiolitis (n = 3, of which one also had croup), and pneumonia (n = 1) in the 14 patients with a high HCoV-NL63 load. None of these diseases was significantly associated with single infection with HCoV-NL63. Discussion The newly discovered coronavirus HCoV-NL63 was detected in a considerable number of nasal aspirates of children under the age of 3 y with LRTIs. With an overall occurrence of 5.2%, it is the third most frequently detected pathogen in this patient group, in which RSV is detected in 31.4%, PIV3 in 9.6%, PIV1 in 2.5%, INF A or INF B in 2.4%, and PIV2 in 0.6%. These viruses were detected with similar frequency in the PRI.DE study [8], arguing against a bias during selection of the analysed samples. HCoV-NL63 is more frequently found in the outpatient group with LRTI (7.9%) than among hospitalised patients (3.2%). PIV3 follows the same pattern (8% and 5%, respectively), but the reverse pattern is observed for RSV (21% and 32%, respectively; [8]). Thus, HCoV-NL63 infection seems to be less pathogenic than RSV infection. Hospitalised HCoV-NL63-positive patients are frequently co-infected with RSV. Nevertheless, several severe disease cases that required uptake in the intensive care unit were linked exclusively to HCoV-NL63 infection in this and our previous survey [1]. Croup is a common manifestation of LRTI in children. The cause is generally assumed to be a respiratory virus and PIV1 has frequently been implicated [12]. Among the 69 samples of patients analysed with croup, croup was indeed frequently linked to PIV1 (14.5%), but PIV3 (15.9%), RSV-A (13.0%), PIV2 (7.2%), and RSV-B (1.4%) were also detected in a considerable percentage of samples. HCoV-NL63 could be detected in 17.4% of these croup patients and was therefore the most frequently identified respiratory virus for croup. Since most of the samples tested were derived from the year 2000–2001, we cannot exclude that the high percentage of HCoV-NL63-positive samples is due to a strong viral activity in this particular year, and long-term studies are needed to determine whether HCoV-NL63 infections occur in cycles peaking every two to three years as observed for other respiratory viruses. Croup has been reported to occur mostly in boys, and it shows a peak occurrence in the second year of life and predominantly in the late fall or early winter season [12]. HCoV-NL63 infection seems to follow these trends: the ratio of boys infected to girls infected is 10:4, the median age in the outpatient group with HCoV-NL63 is 1.55 y, and this virus is circulating mainly in the winter months. Thus, it will be of interest to study the underlying biological reasons for the increased susceptibility of young boys to HCoV-NL63, as this may also explain the higher number of male patients with croup. A preferential occurrence in boys has been described for other respiratory diseases including asthma [13], and human coronavirus infections have previously been associated with exacerbations of asthma [14]. It will therefore also be of interest to study this link for HCoV-NL63. Results from the PRI.DE study indicated that co-infections with multiple respiratory viruses are rare (1.5% of all samples tested; [8]). In contrast, we report detection of more than one viral RNA in 59% of HCoV-NL63-positive samples, which represents 3% of the 949 samples tested. Most co-infections are with RSV-A, probably because of the high percentage of RSV-A infections and an overlap in seasonality. In the winter season the percentage of RSV-positive samples per month can exceed 50% and even the overall difference in percentage of RSV-positive samples among HCoV-NL63-negative and -positive samples was not significant (Fisher's exact test, two-tailed). This contrasts with results obtained for PIV1- and PIV3-positive patients, for whom co-infection with RSV is rarely observed (data not shown). Therefore, infection with RSV seems to reduce infection by PIV1 and PIV3 (or vice versa), but not infection by HCoV-NL63 (or vice versa). Quantitative PCR analysis for HCoV-NL63 revealed a significantly lower HCoV-NL63 viral load in patients co-infected with RSV or PIV3 than in patients infected with HCoV-NL63 alone. This interference effect might be explained by direct competition for the same target cell in the respiratory organs or an elevated activation status of innate immune responses. Prolonged persistence of HCoV-NL63 at low levels is another explanation. The HCoV-NL63 load was found to vary with respect to the time of sampling relative to the time of disease onset, with the higher viral loads in early samples (day 1 or 2 after disease onset). This most likely reflects viral clearance by the immune system. This timing effect may also relate to the differences in HCoV-NL63 load in single versus double infections. For instance, an initial HCoV-NL63 infection may set the stage for a subsequent RSV infection. At the time that this second virus is causing symptoms and NPS samples are collected, the HCoV-NL63 infection may already be under control by the immune system. The initial study on HCoV-NL63 in patients from Amsterdam with respiratory tract illness listed 20% co-infections, which is significantly lower that the 59% that we report in the present study. Differences in handling of the clinical samples may in part explain this. NPS samples were taken in a standardised manner and immediately frozen in liquid nitrogen in the PRI.DE study. Nucleic acid extraction was performed immediately after defrosting. Such optimal sampling and subsequent handling may allow the detection of lower HCoV-NL63 loads (as observed mainly in co-infections). In contrast, the Amsterdam samples were frozen and defrosted repeatedly before nucleic acid isolation, which may have rendered the low load samples negative. This may also explain the higher proportion of HCoV-NL63 positives measured in the current study (5.2% versus 1.4%). Alternatively, HCoV-NL63 might cycle with periods of increased activity like other respiratory viruses and peak every 2–3 y, and the 5.2% incidence in 2000–2001 may represent such a peak year. In conclusion, our study revealed that HCoV-NL63 belongs to the group of most frequently detected viruses in children under 3 y of age with LRTI and that this virus is strongly associated with croup. Recent articles on HCoV-NL63 show that this virus is spread worldwide [15–19]. The virus has been found in different parts of the world: Australia, Canada, Japan, Belgium, and the United States. Thus, HCoV-NL63 is a human respiratory virus that should be added to the list of pathogens that can cause numerous LRTIs in young children. Patient Summary Background Lower respiratory infections (those that are not just coughs and colds) are very frequent in young children and can be serious. Most infections are caused by viruses, the best known of which are respiratory syncytial virus (RSV) and influenza virus (INF). Why Was This Study Done? Recently, a new virus known as HCoV-NL63 has been discovered, which is a human coronavirus (SARS is another coronavirus). Previous work has shown that this virus was present in a child with bronchiolitis. The researchers wanted to know whether the virus was associated with other respiratory diseases. What Did the Researchers Do and Find? They looked at 949 samples taken from children with lower respiratory infections in Germany between 1999 and 2001. They found that the virus HCoV-NL63 was more common in outpatients than inpatients, and that more than 40% of children infected with only this virus had croup compared with around 6% of children who did not carry the virus. What Do These Findings Mean? Although the numbers of all the children infected with this new virus was not high, these results do suggest that this virus is a cause of croup in some children and may be the third most common cause of lower respiratory infections in this group. More work needs to be done to see whether this is true in other years and other countries. Where Can I Get More Information Online? MedlinePlus has Web pages on croup: http://www.nlm.nih.gov/medlineplus/ency/article/000959.htm The Mayo Clinic has information about croup for parents: http://www.mayoclinic.com/invoke.cfm?id=DS00312
- Record: found
- Abstract: found
- Article: found
Human Coronavirus NL63, France
Astrid Vabret, Thomas Mourez, Julia Dina … (2005)
Human coronaviruses (HCoVs) were first recorded in the late 1960s; they are associated mainly with respiratory tract illness but are also involved in enteric and central nervous system diseases. They are represented by 2 prototype strains, HCoV-229E and HCoV-OC43, which belong to antigenic groups 1 and 2, respectively. In 2003, human coronaviruses received worldwide attention with the emergence of severe acute respiratory syndrome (SARS) caused by a novel coronavirus (SARS-CoV). In 2004, the increase in research on theses viruses soon led to the discovery of 2 other human coronaviruses, HCoV-NL63 in the Netherlands and, more recently, CoV-HKU1 in China (1–3). In March 2004, van der Hoek et al. isolated HCoV-NL63 from a nasopharyngeal aspirate taken from a 7-month-old child hospitalized with bronchiolitis, conjunctivitis, and fever (1). One month later, Fouchier et al. characterized the same virus isolated from a nasal swab that had been collected from a child with pneumonia in April 1988 (2). Phylogenetic analysis showed that HCoV-NL63 is a new group 1 coronavirus, most closely related to HCoV-229E. Partial HCoV-NL63 sequences from Australia, Japan, and Canada have been submitted to the GenBank database, which indicates that this virus is distributed worldwide. Two retrospective studies were conducted in the Netherlands, and 11 additional HCoV-NL63–positive samples were detected from November 2000 to February 2003. We tested for HCoV-NL63 in children with acute respiratory tract infection hospitalized in Caen from November 2002 to April 2003, described symptoms associated with this infection, and examined local strains for the genetic variability. We also evaluated a multiplex reverse transcription–polymerase chain reaction (RT-PCR) assay for classical coronaviruses as a tool to test human coronaviruses (except SARS-CoV). Materials and Methods From November 2002 to April 2003, the virology laboratory (University Hospital, Caen, France) received 1,427 respiratory samples (nasal aspirates and swabs) from patients <20 years of age. All specimens were tested for influenza virus A and B; respiratory syncytial virus (RSV); parainfluenza virus 1, 2, 3, and 4; and adenovirus by direct or indirect immunofluorescence or virus isolation. Samples were also tested for human metapneumovirus (HMPV), rhinovirus, enterovirus, and HCoV 229E and OC43 by virus isolation and RT-PCR. A total of 556 samples (39%) were positive for any of these viruses. Symptoms indicated viral infection, as judged by the clinical department; therefore, samples were not tested for bacterial pathogens. Of the 556 positive samples, the following respiratory viruses were detected: RSV (37%, n = 205), rhinovirus (18%, n = 101), influenza virus A and B (15%, n = 86), HMPV (9.7%, n = 54), and HCoV-OC43 (1.2%, n = 7); no HCoV-229E were detected. Of the 871 negative samples, 300 (50 per month) were tested for HCoV-NL63. These 300 samples represented 191 patients <2 years of age (64%), 46 patients 2–5 years of age (15%), and 63 patients 6–20 years of age (21%). All patients were hospitalized with acute respiratory tract illness. Data for 18 patients with recorded HCoV-NL63 infection were available and were examined retrospectively for specific respiratory symptoms. All patients consented to having their samples tested for respiratory viruses, including coronaviruses. Two RT-PCR assays were used to detect HCoV-NL63 in respiratory samples. RNA was extracted by using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions. The first RT-PCR assay was a 1-step simple RT-PCR that amplified a 255-bp fragment of the nucleocapsid (N) gene of HCoV-NL63 by using the following primers: N5-PCR2 (5´-GATAACCAGTCGAAGTCACCTAGTTC-3´) and N3-PCR2 (5´-ATTAGGAATCAATTCAGCAAGCTGTG-3´). The second assay was a 1-step multiplex RT-PCR that amplified the same 255-bp fragment of the N gene of HCoV-NL63, a 574-bp fragment of the membrane (M) gene of HCoV-229E, and a 334-bp fragment of the M gene of HCoV-OC43 by using previously described primers (4,5). These assays (OneStep RT-PCR kit, Qiagen) were undertaken in 25-μL reaction volume containing 2.5 μL RNA extract, 5 μL 5× Qiagen OneStep RT-PCR buffer, 1 μL 10 mmol/L deoxynucleoside triphosphate (dNTP), 1 μL Qiagen OneStep RT-PCR Enzyme Mix, 1.2 μL of 10 mmol/L each primer, 3 μL Qiagen OneStep RT-PCR kit Q solution, and RNase-free water to 25 μL. The reaction was carried out in a GeneAmp PCR system 2700 thermal cycler (Applied Biosystems, Foster City, CA, USA) with an initial reverse transcription step at 50°C for 30 min, followed by PCR activation at 95°C for 15 min, 40 cycles of amplification (30 s at 95°C, 30 s at 58°C, 1 min at 72°C), and a final extension step at 72°C for 10 min. Each RT-PCR test included water controls that were treated identically to the virus samples throughout and was performed with usual precautions to avoid contamination. RT-PCR products were subject to electrophoresis on an agarose gel, stained with ethidium bromide, and visualized under UV light. The comparative analytical sensitivities of these simple and multiplex RT-PCR assays were previously studied on prototype strains by analyzing serial 10-fold dilutions of positive control for HCoVs NL63, OC43, and 229E. The analytical sensitivity was equivalent to detect HCoV-OC43, the multiplex assay was more sensitive (by one 10-fold dilution) to detect HCoV-229E, and less sensitive (by one 10-fold dilution) to detect HCoV-NL63 (data not shown). No cross-reaction of these tests was observed between these coronaviruses. Samples that were positive for HCoVs NL63, 229E, and OC43 were confirmed by using a DNA enzyme immunoassay (GEN-ETI-K DEIA, Sorin, Saluggia, Italy) carried out as recommended by the manufacturer with original probes previously described for HCoVs 229E and OC43 and the following probe defined in the N gene for HCoV-NL63: 5´-(Biotin)CCTCTTTCTCAACCCAGGGCTGATA-3´ (4). A third RT-PCR assay was carried out on 12 HCoV-NL63–positive samples amplifying a 523-bp fragment with spike (S) gene–specific primers NL63-S-sens (position 22557–22582: 5´-ACCGCTGTTAATGAGTCTAGATATG-3´) and NL63-S-antisens (position 23043–23063: 5´-GTCCTGCTATACGGCTTGAA-3´). This assay was performed essentially as described above. The RT-PCR products were purified by using ExoSAP-IT (USB Corporation, Cleveland, OH, USA) and sequenced with the primers by using the CEQ Dye Terminator Cycle Sequencing Quick Start Kit on a CEQ 8000 Genetic Analysis System (Beckman Coulter, Fullerton, CA, USA). The nucleotide sequences of the partial S gene (GenBank accession nos. AY994243–AY994254) were compared with the 2 prototype HCoV-NL63 sequences available in GenBank (NL63-Amsterdam1: NC005831 and NL: AY518894). Both nucleotide and predicted amino acid sequence alignments were prepared by using ClustalX version 1.83. The phylogenetic trees were constructed by using HCoV-229E as an outgroup. Results HCoV-NL63 was detected in 28 (9.3%) of the 300 samples evaluated from November 2002 to April 2003. Twenty-two samples were positive for HCoV-NL63 by both simple and multiplex RT-PCR (Figure 1). Discordant results were found for the remaining 6 samples: 3 were positive only in simple RT-PCR, and 3 were positive only in multiplex RT-PCR. These discordant samples were controlled by using the same methods from the RNA extraction product; the results obtained were identical. The specificity of the RT-PCR products under UV was confirmed by hybridization. Multiplex RT-PCR identified 3 samples with HCoV-OC43 and 1 sample with both HCoV-NL63 and HCoV-OC43. The 28 HCoV-NL63–positive samples were obtained from 18 patients <2 years of age (65%), 4 patients 2–5 years of age (14%), and 6 patients 6–15 years of age (21%). The age distribution of the patients infected by HCoV-NL63 was identical to the age distribution of the sample. Positive specimens were collected throughout the study period; no epidemic was observed. The temporal distribution of HCoV-NL63 infection is shown in Figure 2. Figure 1 Ethidium bromide stain of 2% agarose gel showing reverse transcription–polymerase chain reaction (RT-PCR) products of human coronaviruses (HCoVs). A) Simple 1-step RT-PCR (HCoV-NL63, gene N): lane 1, size markers (100 bp); lane 2, negative control RT-PCR mix; lane 3, positive control HCoV-NL63. B) Multiplex 1-step RT-PCR (HCoVs NL63, OC43, 229E): lane 4, size markers (100 bp); lane 5, negative control RT-PCR mix; lane 6, positive control HCoV-NL63; lane 7, positive control HCoV-OC43; lane 8, positive control HCoV-229E; lane 9, mix of 3 positive control HCoVs (NL63, OC43, and 229E). Figure 2 Number of human coronavirus NL63–positive samples per month. Fifty samples from patients hospitalized for acute respiratory symptoms were tested each month. All patients included in this study had a respiratory tract illness. The medical reports of 18 patients with HCoV-NL63–positive samples were retrospectively examined, and the following symptoms were noted: fever (61%, n = 11), rhinitis (39%, n = 7), lower respiratory tract illness (bronchiolitis, pneumonia [39%, n = 7]), digestive problems (diarrhea and abdominal pain [33%, n = 6]), otitis (28%, n = 5), pharyngitis (22%, n = 4), and conjunctivitis (17%, n = 3). One patient had severe underlying disease (congenital immunodeficiency) and had upper respiratory tract illness with fever, another had a family history of atopic allergy, and pneumonia was diagnosed. Overall, more than one third of the patients infected by HCoV-NL63 had severe lower respiratory tract infection (6 bronchiolitis and 1 pneumonia). All of them recovered completely. To determine if the isolates from France contain different genetic markers, we sequenced a part of the S protein gene of 12 isolates for molecular analysis. The phylogenetic analysis shows that the isolates from France are a divergent group containing sequences with different markers. One isolate (23034101) had characteristics of an outlier (Figure 3A). The phylogenetic analysis of the predicted amino acid sequence also shows that this isolate is an outlier (Figure 3B). However, the branches of this tree are based on only 1 amino acid difference. Care should be taken because of the limited informative sites in the sequence. Figure 3 A) Phylogenetic analysis of a 523-bp region of the partial spike gene of 12 human coronavirus (HCoV)-NL63 isolates from France. To construct the trees, the 2 prototype strains NL63-Amsterdam1 and NL-AY518894 were included. HCoV-229E is used as an outgroup. A) Nucleotide sequence alignments created with ClustalX 1.83; bootstrap values ≥70 are indicated. B) Predicted amino acid sequences; bootstrap values ≥50 are indicated. Discussion A number of viruses cause respiratory infections, and many infections cannot be attributed to any known pathogen (6). This fact may be because some detection methods lack sensitivity, because some respiratory viruses are not systematically tested for, or because some pathogens are not yet identified. Of the 4 novel agents, HMPV, SARS-CoV, HCoV-NL63, and CoV-HKU1, identified recently, 3 were coronaviruses (1,3,7–9). Coronaviruses infect many species of mammals and birds, they possess the largest genome of all RNA viruses (≈30 kb), and they have a high frequency of recombination. In addition, the potential to infect other species has been described for bovine coronavirus and is suspected to have caused the SARS outbreak (10,11). Therefore, coronaviruses represent a potential major infectious agent in humans. Based on genotypic and serologic characteristics, coronaviruses were divided into 3 distinct groups: with HCoVs 229E and NL63 in group 1 and HCoVs OC43 and HKU1 in group 2. SARS-CoV is not definitively assigned to any of these groups. However, an early split-off of SARS-CoV from the group 2 lineage was suggested (12). Until recently, only the HCoVs 229E and OC43 and SARS-CoV have been thoroughly studied. As suggested by epidemiologic surveys conducted in the 1970s, human coronaviruses are distributed worldwide and circulate during seasonal outbreaks (13–15). In this study, we determined whether this is also the case for HCoV-NL63. Furthermore, we looked at the symptoms of a HCoV-NL63 infection and the heterogeneity of the virus isolate circulating in France. In this study, 9.3% of the samples were positive for HCoV-NL63. These results suggest that HCoV-NL63 can frequently cause infections, particularly in young children. Because of availability, only samples that tested negative for other respiratory viruses were included in this study. Consequently, we could not identify co-infections. Nevertheless, by using multiplex RT-PCR, which simultaneously detected the classical human coronaviruses (OC43, 229E, and NL63), we detected 1 co-infection by HCoVs NL63 and OC43 and 3 HCoV-OC43–positive samples. These additional cases of HCoV-OC43 infection in our patients can be explained by the fact that multiplex RT-PCR was performed directly on respiratory samples, whereas in previous routine tests, samples were first instilled into a cell culture system (HUH7 cell line) and RT-PCR was then performed on cell culture supernatant. Detecting human respiratory coronaviruses requires molecular techniques because of difficulties in virus culture and lack of an assay to detect intracellular antigens or others serologic assay. A multiplex RT-PCR is therefore a useful tool to simultaneously test for various HCoVs from a clinical sample. This study showed that the clinical sensitivity of multiplex RT-PCR was equivalent to simple RT-PCR, allowing clinical studies and routine testing. No HCoV-229E was detected in samples. HCoVs 229E and NL63 both belong to antigenic group 1. The percentage amino acid sequence identities between the S, M, and N proteins of HCoVs NL63 and 229E are 54.7%, 61.5%, and 43.2%, respectively (2). A cross-protective immune response could explain why these 2 human coronaviruses do not circulate at the same time. We detected HCoV-NL63 in respiratory specimens in February with a frequency of 18%. These results correlate with the fact that human coronaviruses circulate primarily in the winter. However, HCoV-NL63 was found in nasal aspirates each month of our study. The clinical symptoms associated with HCoV-NL63 still need to be determined. In the patients in our study, symptoms included not only respiratory symptoms but also lower respiratory tract diseases such as bronchiolitis, bronchitis, and pneumonia. Human coronaviruses, except SARS-CoV, generally cause disease much like the common cold, but they have also been associated with more severe lower respiratory tract conditions, especially in frail patients (4,16). Whether HCoV-NL63 is also responsible for coldlike illnesses in healthy adults, as has been described for HCoVs 229E and OC43, must be determined. The same can be said about the very recently described coronavirus CoV-HKU1. This virus was identified in a 71-year-old patient with chronic obstructive airway disease who was hospitalized with pneumonia (3). Digestive problems were noted in approximately one third of patients. No clear evidence exists that human coronaviruses, except SARS-CoV, cause enteric illness, but previous studies have suggested that these viruses may be involved in enteric diseases (17–20). Further studies must be conducted to detect coronaviruses in stool samples and clarify the origin of these digestive symptoms. The S protein of coronaviruses is a major determinant of cell tropism and pathogenicity and a major inducer of neutralizing antibodies (21). Furthermore, heterogeneity of the S gene has been observed for different HCoV-NL63 strains. We amplified part of the S gene to study the variability of our isolates. Phylogenetic analysis showed that several different isolates are cocirculating in France, similar to the situation in the Netherlands, Australia, Canada, and Belgium. In conclusion, HCoV-NL63 can be found in patients with upper and lower respiratory tract illness, particularly in hospitalized children. This observation is the first of HCoV-NL63 infection in France, and several isolates of HCoV-NL63 were found to circulate in our country. The sensitive multiplex RT-PCR for the HCoVs NL63, 229E, and OC43 that we developed is a useful tool to facilitate the routine detection of these pathogens. This project was supported by the European Commission EPISARS contract (No. SP22-CT-2004-511063) and the Programme de Recherche en Réseaux Franco-Chinois (épidémie du SRAS: de l'émergence au contrôle).
Author and article information
Journal
Journal ID (nlm-ta): Viruses
Title:
Viruses
Publisher:
Molecular Diversity Preservation International (MDPI)
ISSN
(Electronic):
1999-4915
Publication date Collection:
December
2009
Publication date
(Electronic):
30
October
2009
Volume: 1
Issue: 3
Pages: 647-656
Affiliations
[1
] Laboratory of Experimental Virology, Department of Medical Microbiology, Center for
Infection and Immunity (CINIMA), Academic Medical Centre (AMC), University of Amsterdam,
Meibergdreef 15, 1105 AZ, Amsterdam, The Netherlands; E-Mails:
r.dijkman@
123456amc.uva.nl
(R.D.);
h.l.mulder.1@
123456student.rug.nl
(H.L.M.);
lynne.rumping@
123456student.uva.nl
(L.R.);
ilse.kraaijvanger@
123456student.uva.nl
(I. K.);
m.deijs@
123456amc.uva.nl
(M.D.);
m.f.jebbink@
123456amc.uva.nl
(M.F.J.)
[2
] Department of Virology, Biomedical Primate Research Centre (BPRC), Lange Kleiweg
139, 2280 GH, Rijswijk, The Netherlands; E-Mail:
verschoor@
123456bprc.nl
(E.J.V.)
Author notes
[*
]Author to whom correspondence should be addressed; E-Mail:
c.m.vanderhoek@
123456amc.uva.nl
; Tel.: +31-20-5667510; Fax: +31-20-6916531.
Article
Publisher ID: viruses-01-00647DOI: 10.3390/v1030647
PMC ID: 3185515
PubMed ID: 21994563
SO-VID: 671274d8-9023-4bfd-9ef9-c39334476261
Copyright © © 2009 by the authors; licensee Molecular Diversity Preservation International, Basel,
Switzerland.
License:
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license ( http://creativecommons.org/licenses/by/3.0/).
History
Date
received
: 26
August
2009
Date
revision received
: 28
October
2009
Date
accepted
: 30
October
2009
Categories
Subject:
Communication
ScienceOpen disciplines: Microbiology & Virology