INTRODUCTION Acinetobacter baumannii is an opportunistic, Gram-negative pathogen that thrives in clinical settings and is often multidrug resistant (MDR), factors which earn it a place among the ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens of clinical importance (1). Some recent isolates are resistant to all typically used antibiotics except colistin and tigecycline and thus are called extensively or extremely drug-resistant (XDR) A. baumannii (2). MDR/XDR A. baumannii strains are a worldwide problem for clinicians and caregivers in the hospital setting, particularly in the intensive care unit (ICU) (3). A. baumannii is also often isolated from infections of severe wounds sustained in military combat. These infections are responsible for increased morbidity, with prolonged wound healing and amputations of extremities when limbs cannot be salvaged (4, 5). A. baumannii was a predominant isolate from wounded soldiers serving in Iraq (4, 5) and was associated with wartime polytrauma injuries in the past (6). Additionally, there may be a link between A. baumannii and crush injuries, as A. baumannii infections were also prevalent after the recent large earthquakes in Haiti (7) and China (8). Another disturbing development that has increased the clinical importance of A. baumannii infections is that many strains have become highly antibiotic resistant. For example, in previous decades, A. baumannii isolates obtained from both military and civilian settings were often carbapenem sensitive. Now, the majority of U.S. military isolates are carbapenem resistant (9). This trend has also been mirrored in civilian hospitals around the world (10). Recently, even colistin-resistant strains have emerged in the military health care system (11). The latter development is deeply troubling, as colistin is considered the last line of defense against these MDR isolates. Exacerbating this problem is the lack of new treatments in the pharmaceutical pipeline (12); therefore, research on A. baumannii virulence factors is urgently needed, as they could constitute potentially novel targets for future antimicrobials. While previous studies attempted to examine the virulence of different clinical A. baumannii strains utilizing in vivo model systems (13, 14), the majority of A. baumannii researchers still use two American Type Culture Collection (ATCC) strains, ATCC 19606T and ATCC 17978, which were isolated more than 50 years ago and are not significantly antibiotic resistant. These strains are certainly more amenable to genetic manipulation than most clinical isolates (15, 16) and share considerable genome homology (>90%) to current A. baumannii isolates (17), but they are not representative of contemporary isolates of this rapidly evolving pathogen. Some researchers, recognizing that the ATCC isolates are dated, have performed studies with more recent clinical isolates; however, genetic manipulation of such isolates has depended on susceptibility to aminoglycosides (18 – 20), which is often not found in clinical strains (21). Therefore, our goal was to carry out a systematic study of our own contemporary clinical strains isolated from patients in the U.S. military health care system to identify a strain that is more representative of current clinical isolates, that is highly virulent in established model infections, and that can be genetically manipulated without a potential sacrifice with respect to virulence and antibiotic resistance. Not only does identifying such a strain account for more recent clinical outcomes, but the increased virulence in animal models allows greater statistical power in screening new therapeutics. Moreover, the ability to manipulate the genome allows the study of virulence factors, some of which may be responsible for the emergence of this pathogen in more recent years. RESULTS Defining genetic characteristics of A. baumannii isolates. In order to identify potential reference strains, a diverse set of 33 A. baumannii isolates was chosen based on genetic, isolation site, and antibiotic resistance differences from more than 200 A. baumannii strains isolated between 2004 and 2010 from patients in the U.S. military health care system. AB0057, first isolated in 2004 at Walter Reed Army Medical Center, was also included as a comparator because this strain is well characterized, and its genome was previously sequenced (22). The diversity set of A. baumannii isolates was determined via pulsed-field gel electrophoresis (PFGE) analysis and a multiplex PCR assay previously developed to identify the international clonal complexes (ICC). Separately, antibiograms were determined using two different automated bacterial identification systems. The majority of strains were found to be multidrug resistant, typical of current clinical strains (see Table S1 in the supplemental material). As shown in Fig. 1, the genetic similarity of the strains, as determined by PFGE, ranged from 45 to 100%. PFGE types were considered to represent the same clones when their genetic similarity was >80% (23); based on this cutoff, the 33 strains represent 19 unique clones. When the genetic relatedness of these 19 clones was compared, it was found that the majority of them clustered into three groups, which generally aligned with the ICC designations determined by multiplex PCR (Fig. 1 and Table 1) (24). Exceptions were the isolates AB3560, AB4456, and AB4857, which were determined to be ICC III by the multiplex assay but appeared to be ICC I via PFGE. In this case, we relied on the multiplex data (Table 1) to be definitive. These data were used to select four representative strains for genome sequencing and evaluation in animal models. FIG 1 Pulsed-field gel electrophoresis of A. baumannii strains. Genomic DNA was isolated from 33 A. baumannii clinical isolates, digested with ApaI, and separated by pulsed-field gel electrophoresis (PFGE). Patterns of electrophoresis were compared using BioNumerics 6.0 software. The ICC was determined by multiplex PCR analysis, and brackets delineate the approximate grouping of each strain. TABLE 1 A. baumannii strains used in this study a Strain MRSN Isolation site Yr isolated Clonal complex b Source AB001 1332 ND ND ND C. Murray AB002 1333 ND ND ND C. Murray AB0057 1311 Blood/sepsis 2004 I This study AB967 1308 Blood/sepsis 2003 III This study AB2828 846 Blood/sepsis 2006 III This study AB3340 847 Blood/sepsis 2006 I This study AB3560 848 Blood/sepsis 2006 III This study AB3638 849 Posterior wound 2007 III This study AB3785 853 Blood/sepsis 2007 II This study AB3806 854 Leg wound 2007 III This study AB3917 1309 Blood/sepsis 2007 ND This study AB3927 856 Tibia/osteomyelitis 2007 I This study AB4025 858 Femur/osteomyelitis 2007 II This study AB4026 859 Fibula/osteomyelitis 2007 II This study AB4027 860 Femur/osteomyelitis 2007 II This study AB4052 863 War wound 2007 II This study AB4269 877 War wound 2007 II This study AB4448 899 War wound 2007 I This study AB4456 903 Tracheal aspirate 2007 III This study AB4490 906 War wound 2008 I This study AB4498 907 Blood 2008 II This study AB4795 930 Bone/osteomyelitis 2008 II This study AB4857 939 Ischial/osteomyelitis 2008 III This study AB4878 941 War wound 2008 II This study AB4932 949 Sputum 2008 II This study AB4957 951 Sacral/osteomyelitis 2008 II This study AB4991 953 War wound 2008 I This study AB5001 954 Blood/sepsis 2008 II This study AB5075 959 Tibia/osteomyelitis 2008 I This study AB5197 960 STS/tissue 2008 I This study AB5256 961 Blood/sepsis 2009 NA This study AB5674 963 Blood/sepsis 2009 I This study AB5711 1310 Blood/sepsis 2009 II This study ATCC 19606T NA Urine 1948 ND ATCC ATCC 17978 NA Spinal meningitis 1951 ND ATCC RUH134 NA Urine 1982 II L. Dijkshoorn RUH875 NA Urine 1984 I L. Dijkshoorn RUH5875 NA Unknown, Netherlands 1997 III L. Dijkshoorn ACICU NA Outbreak isolate, Rome, Italy 2005 II M. Tolmasky a MRSN, The Multidrug-resistant Organism Repository and Surveillance Network; ND, no data; NA, not applicable; STS, sterile swab site (most likely from an infected wound). b As determined by multiplex assay performed in this study. AB5256 was considered NA because only the OXA-51 amplicon was amplified from group 1 primer set (31). Three of the strains chosen each represented one of the three ICC groups, AB5075 (ICC I), AB5711 (ICC II), and AB4857 (ICC III). The fourth strain, AB5256 was an outlier, as the OXA-51 allele from this strain was amplified with group 1 primers (24), while the csuE allele was not. The isolates were sequenced (25) and compared to previously sequenced A. baumannii genomes using the BLAST score ratio (BSR) approach (26). This method compares putative peptides encoded in each genome based on the ratio of BLAST scores to determine if they are conserved (BSR value ≥ 0.8), divergent (0.8 > BSR > 0.4), or unique (BSR 0.4; however, each isolate also had a set of unique proteins (see Table S2 in the supplemental material). These results are similar to what has been found previously with MDR A. baumannii clinical isolates (17), suggesting that the strains used in this study are not genetic outliers. Virulence assessed in the Galleria mellonella model. Strains were first tested in a Galleria mellonella infection model, as this model is well established to assess virulence and novel therapeutics for bacterial pathogens, including A. baumannii (27, 28). G. mellonella larvae were infected with an approximate dose of 1.0 × 105 CFU with each of the four sequenced A. baumannii isolates, AB4857, AB5075, AB5256, and AB5711, as well as control strain AB0057. Worms were observed for 6 days, and death was recorded. Within 24 h postinfection, approximately 25% of AB5075-infected worms remained, while the other four strains had survival rates of 70% or higher (Fig. 2). By the end of the 6-day study, AB5075-infected worms had a survival rate of 16%; strains AB4857 and AB5256 were considered moderately pathogenic in this model, with survival rates of 50% and 35%, respectively. The least lethal strains were AB5711 and AB0057, with survival rates of 85% and 83%, respectively. Phosphate-buffered saline (PBS)-injected control worms displayed 100% survival through the course of the study. Based on these data, it was hypothesized that AB5075 was more virulent than the other four strains tested. Using the Mantel-Cox test with Bonferroni correction for multiple comparisons, Kaplan-Meier curves were compared, and AB5075 was found statistically to be more lethal than AB4857, AB5711, and AB0057 (all P values 0.4, and (Epicentre, Madison, WI). The transposable element was created by PCR amplifying hph, encoding hygromycin resistance, from vector pMQ300 (31) using the primers pMODHygForKPN (AAAAAAGGTACCggaaatgtgcgcggaacccc) and pMODHygRevPST (AAAAAACTGCAGttggtctgacaatcgatgcgaattgg). The amplicon was then cloned into the multicloning site (MCS) of pMOD-5 . The transposome was constructed according to manufacturer’s instructions and introduced into cells via electroporation. The transformed cells were selected for on LB agar supplemented with 250 µg/ml hygromycin. Colonies were picked from plates and grown overnight in 96-well plates containing 100 µl of low-salt LB supplemented with 250 µg/ml hygromycin. After overnight incubation, 100 µl of 50% glycerol was added to each well, and plates were immediately moved to −80°C for storage. The Tn5 mutant library was subjected to high-throughput sequencing as previously described (32). Construction of hygromycin mini-Tn7 vector and insertion onto the chromosome. To make Tn7-based genetic tools usable in AB5075, the hph gene, coding for hygromycin resistance, was cloned into pUC18T-mini-Tn7T-Zeo (40). Briefly, hph was amplified from pMQ300 (31) using primers pMOD Hyg For (AAAGCATGCggaaatgtgcgcggaacccc) and pMOD Hyg Rev (AAAGCATGCttggtctgacaatcgatgcgaattgg) (lowercase letters represent the actual primer; capital letters are the restriction site for each primer and a poly-A overhang) and ligated into pUC18T-mini-Tn7T-Zeo, which was digested with NcoI and then blunted with the Klenow fragment of the DNA polymerase I (Fermentas). A derivative of the pUC18T-mini-Tn7T-hph vector containing the lux operon was constructed by amplifying the luxABCDE operon out of pUC18T-mini-Tn7T-Gm-lux (40) with the primers Lux For (TCAAGGTTCTGGACCAGTTG) and Lux Rev (AAAAAAAAGCTTGGTGTAGCGTCGTAAGCTAATA). The PCR product was digested with BamHI and HindIII and then cloned into the MCS of pUC18T-mini-Tn7T-hph. The mini-Tn7 elements were transposed into the attTn7 site of AB5075 via the method of Kumar et al. (41). Conjugation mixtures were scraped from LB plates, resuspended in 1 ml of PBS, and plated on LB agar supplemented with 250 µg/ml of hygromycin and 25 µg/ml of chloramphenicol. Insertion into the attTn7 site was confirmed with the primers AB5075 attTn7 FWD (AACACAAGTGGAAGTGATTTCT) and AB5075 attTn7 REV (TGGCTTGCACCAATCATTTATAG), which flanked the attTn7 site. Statistical analyses. All statistical analyses were carried out using GraphPad Prism version 5.01 for Windows (GraphPad Software, San Diego, CA). Survival curves were compared via Kaplan-Meier curve analysis with the Bonferroni correction for multiple comparisons. Recovered bacterial burdens were compared via either the Mann-Whitney U test or the Kruskal-Wallis test followed by Dunn’s multiple-comparison test. All results were considered significant at a P value of 0.4 but <0.8 indicates a divergent sequence, and a BSR of <0.4 indicates a unique sequence. Table S2, DOCX file, 0.1 MB. Text S1 Supplemental methods and results. Download Text S1, DOCX file, 0.1 MB
