Oncogenic mutations of the H3F3A gene, which encodes histone variant H3.3, are present
in the majority of pediatric brainstem gliomas
1,2
. The most common H3F3A mutation causes a substitution of lysine 27 with methionine
(i.e., K27M), abolishing a critical site of regulatory post-translational methylation.
We, and others, have demonstrated that these oncogenic mutations have a dominant effect,
sequestering polycomb repressive complex 2 (PRC2) and reducing cellular H3K27 methylation
3–6
. As such, tumor-derived histone gene mutations are thought to drive tumorigenesis
by causing reduced histone K27 methylation and thereby altering gene expression in
cells of the developing pons. We hypothesized that pharmacologic reversal of brainstem
glioma H3K27 demethylation could serve as a therapeutic strategy for this uniformly
lethal malignancy
7
.
To test this hypothesis, we studied two K27M mutant brainstem glioma cell lines (SF7761
8
and SF8628
9
), four glioma cell lines with wild-type H3.3 (SF9012, SF9402, SF9427, and GBM43),
a glioma cell line expressing G34V-mutant H3.3 (KNS42), and isogenic human astrocytes
(HAs) with and without transgene expression of K27M H3F3A
3
(all lines derived from human; see Supplementary Table 1 for relevant clinical information).
Immunoblot and immunocytochemistry analysis showed that K27M glioma cells and K27M
HAs (hereafter “K27M-expressing cells”) have less di- and trimethylated H3K27 (K27me2
and K27me3) than glioma cells with wild type and G34V H3.3 (Fig. 1a and Supplementary
Figs. 1 and 2).
H3K27 is methylated by histone-lysine N-methyltransferase EZH2, a component of PRC2,
and is demethylated by the KDM6-subfamily K27 demethylases JMJD3 and UTX
10–12
. Treatment of all cell sources with GSKJ4
13
, an ethyl ester derivative of the H3K27 demethylase inhibitor GSKJ1, led to higher
K27me2 and K27me3 in K27M-expressing cells (Fig. 1b and Supplementary Figs. 2 and
3), with increasing length of treatment leading to increasing K27me2 and K27me3 (Fig.
1c).
We analyzed the effects of GSKJ4 treatment in vitro on tumor cell proliferation, apoptosis
and colony formation. GSKJ4 treatment of K27M-expressing cells revealed a dose-dependent
inhibition of cellular viability, with 50% growth inhibition reached at concentrations
of 1.3–3.0 μM (Fig.1d). In contrast, GSKJ4 concentrations as high as 8 μM did not
achieve 50% growth inhibition for any of tumor cells expressing wild-type and G34V
H3.3. GSKJ4 treatment of HAs revealed that HAs expressing K27M were more sensitive
to GSKJ4 than HAs without the mutation (Fig. 1d). Analysis of cell cycle distributions
revealed S-phase as being most diminished cell cycle stage in tumor cells expressing
K27M (Supplementary Fig. 4). GSKJ4 also led to more apoptosis of K27M cells, as indicated
by annexin V staining (Supplementary Fig. 5) and by cell counts of GSKJ4-treated samples
(Supplementary Fig. 6). Finally, GSKJ4 completely inhibited the clonal growth of all
K27M-expressing cells but had no affect on the clonal growth of the cells expressing
wild-type and G34V H3.3 (Fig. 1e). Analysis of tumor cell proliferation after inhibition
of EZH2 by GSK126
14
revealed little effect of the methyltransferase inhibitor on any cell line tested
(Supplementary Fig. 7a) despite evidence of less K27me3 and K27me2 in treated cells
(Supplementary Fig. 7b).
To confirm that the effect of GSKJ4 on tumor cell growth was due to activity against
JMJD3, we studied the effects of depleting JMJD3 and UTX on tumor cell growth and
the response of these depleted cells to GSKJ4. siRNA-mediated depletion of JMJD3 inhibited
the growth of K27M cells. GSKJ4 had no significant effect on proliferation of JMJD3
depleted K27M cells (Supplementary Fig. 8). siRNA depletion of UTX had little effect
on the growth of K27M cells, and pre-treatment of K27M cells with UTX (KDM6A) siRNA
did not prevent GSKJ4 from significantly inhibiting K27M cell growth (P < 0.03 for
K27M cells versus wild-type cells, two-tailed unpaired t-test; Supplementary Fig.
9). These results support the anti-tumor activity of GSKJ4 as involving inhibition
of JMJD3, but do not exclude the possibility of other histone demethylase activities
being affected (see http://www.thesgc.org/chemical-probes/GSKJ1).
To determine whether GSKJ4 is active against K27M brainstem gliomas in vivo, we administered
GSKJ4 by intraperitoneal injection, at 100 mg per kg per day for 10 consecutive days,
to athymic mice harboring subcutaneous SF8628 K27M xenografts. The drug showed significant
growth-inhibitory activity against SF8628 subcutaneous tumors (Fig. 2a). The same
cells, when transfected with JMJD3 (KDM6B) siRNA and then injected subcutaneously,
showed substantial growth delay relative to the growth of SF8628 cells transfected
with scrambled siRNA (Fig. 2b).
We next tested for GSKJ4 activity against orthotopic K27M brainstem glioma xenografts
(SF7761 and SF8628)
8,15
. Administration of GSKJ4 for 10 consecutive days significantly reduced the growth
of K27M tumors engrafted in mouse brainstem and significantly extended animal survival
(Fig. 2c). Analysis of K27M tumors obtained from mice at the end of therapy showed
significantly reduced Ki-67 staining—a measure of cell proliferation—as well as significantly
increased TUNEL positivity—a measure of apoptotic activity—after GSKJ4 treatment (Fig.
2d). In addition, GSKJ4 treatment significantly increased tumor cell K27me3 positivity
(P = 0.0016, two-tailed unpaired t-test; Supplementary Fig. 10). In contrast to K27M
tumors, xenografts established from GBM43 cells expressing wild-type H3.3 showed no
response to GSKJ4 treatment (Fig. 2c).
To address GSKJ4 brain access, we administered GSKJ4 to three non-tumor-bearing mice
that were euthanized 3 h after the third GSKJ4 treatment. Their brains were immediately
resected, and each brainstem was dissected from the surrounding brain. HPLC analysis
of tissue extracts revealed detectable GSKJ1, the hydrolysis product and activated
derivative of GSKJ4, in all three brainstem samples (Supplementary Table 2). This
finding indicated that the drug entered the brain: specifically, the site of brainstem
tumor development.
Drawing on known associations between K27 methylation and gene regulation, we applied
expression array and K27me3 chromatin immunoprecipitation–sequencing (ChIP-seq) analysis
to SF8628 K27M cells. Results for sequences showing the most significant inverse correlation
between GSKJ4-associated gene expression changes and K27me3 sequence association are
indicated in Supplementary Fig. 11 and Supplementary Table 3 (see also Gene Expression
Omnibus data set GSE8497).
The recent discovery of histone K27M mutation in pediatric gliomas and the identification
of the altered epigenetic program resulting from these mutations has prompted the
investigation of small-molecule inhibitors targeting H3 demethylases as new cancer
therapies. Here we have demonstrated that pharmacologic modulation of histone K27
methylation, by inhibiting H3 demethylation, is an approach warranting further investigation
for treating K27M pediatric gliomas.
Methods
Cell sources and propagation
Primary pediatric human glioma cells, designated with “SF”, were obtained from surgical
biopsy of tumor from patients admitted to UCSF medical center, and in accord with
an institutionally approved protocol by the UCSF Committee for Human Research (IRB#
10-01318). Subjects, or their legal guardians if the subject was a minor, provided
informed consent. Human astrocytes (HAs) were obtained from Z. Zhang (Mayo Clinic).
These cells were modified to express wild-type (WT) H3F3A or K27M H3F3A transgene
as previously described
3
. Establishment of glioma cell cultures, from surgical specimens, and tumor cell modification
for expression of firefly luciferase, for in vivo bioluminescence imaging, has been
described
8,9,15
. GBM43 is maintained as a serially-passaged subcutaneous xenograft
16
, with xenograft tissue used to establish explant cultures for in vitro experiments
that are described below. Cell line KNS42, with H3F3A G34V mutation (substitution
of glycine 34 with valine)
17
, was obtained from the Japanese Collection of Bioresources and was established from
a 16 year old male.
Nuclear protein extraction and immunoblotting
Nuclear proteins were extracted from proliferating cells in acid extraction buffer
(0.2N HCL), following the extraction of cytoplasmic proteins with TNE buffer: 150
mM NaCl, 10 mM Tris pH 7.4, 1% Triton X-100, 5 mM EDTA, 1% NP40, 1 μM DTT, and proteinase
(Roche) plus phosphatase (Sigma) inhibitor cocktails. Protein extracts were resolved
by SDS-PAGE and transferred to poly(vinylidene difluoride) (PVDF) membranes. After
probing with primary antibodies, the membranes were incubated with horseradish peroxidase-conjugated
secondary antibody, and signals visualized by ECL (GE Healthcare). Antibodies specific
for total histone H3 (96C10, 1:1,000), H3K27me3 (C36B11, 1:1,000), H3K27me2 (D18C8,
1:1,000), H3K27me1 (#7693 1:1,000), and EZH2 (D2C9, 1:1,000), were obtained from Cell
Signaling Technologies. Histone H3.3 antibody (ab97968, 1:1,000) was obtained from
Abcam, and histone K27M mutant antibody (ABE419, 1:1,000) was from EMD Millipore.
Immunocytochemistry
Tumor cells were fixed on coverslips in 4% paraformaldehyde (PFA), rinsed in PBS,
and blocked in PBS containing 0.3% Triton X-100 and 5% FBS for 1 h at room temperature.
Coverslips were incubated with H3K27me3 antibody (C36B11, Cell Signaling, 1:800) or
JMJD3 antibody (ab154985, Abcam, 1:800) in PBS containing 0.3% Triton X-100 and 5%
FBS overnight at 4 °C. Overnight incubations were followed by incubations using goat-anti-rabbit
Alexa568 secondary antibody (Invitrogen, 1:800) in PBS containing 5% FBS, for 50 min
at room temperature and in the absence of light. Coverslips were rinsed in PBS four
times and the nuclei were stained with DAPI in PBS at room temperature. Coverslips
were then subjected to successive rinses in PBS and sterile water and then mounted
on glass slides using Vectashield (Vector Laboratories) and analyzed with a Zeiss
LSM 510 NLO Meta microscope at 1,000 × magnification.
Cell viability, cell proliferation, and clonogenic assays
For determination of cell viability effects of GSKJ4, tumor cells were seeded in 96-well
plates, at 5,000 cells per well, and cultured in the presence of 0–8 μM GSKJ4 (R&D
Systems) or GSK126 (Xcess Biosciences) for 72 h, with quadruplicate samples for each
incubation condition. Relative numbers of viable cells were determined using CellTiter
96® AQueous One Solution Cell Proliferation Assay (Promega). IC50 values were calculated
by nonlinear least-squares curve-fitting. Inhibitor proliferation effects were determined
by cell counting from samples obtained at 0, 1, 2, 3, and 6 d in the presence of vehicle
(DMSO) or with IC50 concentrations of GSKJ4 (SF7761, SF8628, HA KM) or with 3 μM GSKJ4
(SF9402, SF9427, HA WT, GBM43, KNS42). Clonogenic assays were performed by plating
at 300–1,000 cells/ml in 60-mm plates, with cells treated with vehicle, with IC50
concentrations of GSKJ4 (SF7761, SF8628, HA KM), or with 3 μM GSKJ4 (SF9402, SF9427,
HA WT, GBM43, KNS42) for 72 h, beginning 3 d after plating. Cells were incubated for
3 weeks at 37 °C and then stained with 0.05% crystal violet.
Xenograft studies
Six-week-old female athymic mice (nu/nu genotype, BALB/c background) were purchased
from Simonsen Laboratories and housed under aseptic conditions. All protocols, described
below, were approved by the UCSF Institutional Animal Care and Use Committee.
Tumor cells were implanted into the pontine tegmentum of athymic mice as previously
described
8,15
. Briefly, mice were anesthetized by intraperitoneal (ip) injection of a mixture containing
ketamine (100 mg per kg) and xylazine (10 mg per kg) in 0.9% saline. A 1-cm sagittal
incision was made along the scalp, and the skull suture lines were exposed. A small
hole was created by puncture with a 25-gauge needle at 1.5 mm to the right of the
bregma and posterior to the lambdoid suture. With use of a sterile Hamilton syringe
(Stoelting), 1 × 105 cells/μl in Hank’s balanced salt solution, without Ca2+ and Mg2+
were slowly injected into the pontine tegmentum at 5-mm deep from the inner base of
the skull. Mice were monitored daily and euthanized at indication of progressive neurologic
deficit or found in a moribund condition. For subcutaneous tumor cell implantation,
4 × 106 cells, in 0.4 ml of cell culture media with matrigel (BD Bioscience) were
injected in the right flank of mice. For testing the effect of JMJD3 siRNA in vivo,
2 × 105 tumor cells transfected with JMJD3 siRNA (Ambion oligo ID: s23110) or scrambled
control siRNAs for 72 h were injected into the right flank of mice. Tumor growth and
response to therapy were determined twice weekly by bioluminescence imaging. For imaging,
mice were anesthetized as described above and examined for tumor bioluminescence 10
min following ip injection of D-luciferin (potassium salt, 150 mg per kg, Gold Biotechnology).
Signal intensities were quantified within regions of interest, as defined by the Living
Image software. Bioluminescence measurements for each animal at each time point were
normalized against corresponding readings obtained at the beginning of therapy.
For the in vivo therapy-response analysis, ten mice were randomly assigned to vehicle
(DMSO, n = 5) and GSKJ4 (n = 5) treatment groups, with GSKJ4 administration by ip
injection at 100 mg per kg, with once-daily administration for 10 consecutive days.
An additional two mice, not included in the survival analysis, were sacrificed 6 h
after administration of final treatment, with the brains of these mice resected and
placed in 4% PFA.
Immunohistochemical analysis
PFA-fixed mouse brains were paraffin-embedded and sectioned (10 μm) for immunohistochemical
analysis of effect of therapy on cell proliferation, as indicated by positivity for
Ki-67 staining (2 μg/ml, Ventana Inc.), and on K27 methylation, as indicated by positivity
for H3K27me3 staining (C36B11, Cell Signaling, 1:500). To assay for apoptotic response
to treatment, TUNEL staining was performed using the ApopTag® Peroxidase In Situ Apoptosis
Detection Kit (S7100, Millipore) according to the manufacturer’s protocol.
Statistical analyses
The Kaplan–Meier estimator and Prism software were used to generate and analyze survival
plots. Differences between survival plots were calculated using a log-rank test. Two-way
ANOVA with Bonferroni post-test was used for comparison of annexin V staining. For
all other comparisons, a two-tailed unpaired t-test was used (GraphPad Software).
No statistical method was used to predetermine sample size. The investigators were
not blinded to allocation during experiments and outcome assessment. The experiments
were not randomized. In the in vivo therapy-response experiments, intracranial tumor
bioluminescence signals were ranked from highest to lowest on the day of initiating
therapy, and animals were assigned to treatment groups on an alternating basis, as
determined by rank order, such that the mean tumor bioluminescence signals for each
treatment group were approximately equal at the time of therapy initiation.
Online Methods
Cell cycle analysis and apoptosis assay
GSKJ4 cell cycle effects were determined by treating cells with 3 μM GSKJ4 for 72
h, pulsing cells with 10 μmol/l 5-ethynyl-2′-deoxyuridine (EdU) for 30 min, and then
collecting and staining cells with Alexa Fluor 647-azide using a Click-iT assay kit
(Life Technologies). DNA was stained using 1 mg/ml DAPI. Cells were then subjected
to flow cytometric analysis, using a BD FACSCalibur™ instrument, with data analyzed
using FlowJo 8.1 software. Cell apoptosis was assessed with the Alexa Fluor 488 Annexin
V/Dead Cell Apoptosis kit (Life Technologies).
siRNA oligonucleotide treatments
JMJD3 (KDM6B), UTX (KDM6A), and scrambled control siRNAs (Ambion oligo IDs JMJD3 siRNA
A: s23109, B: s23110, and UTX siRNA A: s14737, B: s14736) were used to transfect tumor
cells at a concentration of 30 nM using Oligofectamine reagent (Invitrogen) according
to the manufacturer’s instructions. Cells were incubated with siRNAs for 96 h, after
which relative number of viable cells was determined, as described above.
Quantitative PCR for determination of JMJD3 (KDM6B) and UTX (KDM6A) gene expression
Total RNA was extracted from cell lines following treatment of JMJD3 and UTX siRNA
for 72 h, and cDNA was synthesized by reverse transcription (RT), using the iScript
cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed in a 15-μl reaction mixture
using Maxima SYBR master mix (#K0221, Thermo Scientific). Fluorescence data were collected
at annealing stages, and real-time analysis performed with SDS v2.3 software (Applied
Biosystems). Ct values were determined using automatically set baseline and fluorescence
thresholds. Fold changes were calculated using the ΔΔCt method and normalized against
GAPDH and ACTB expression. Forward and reverse primers, respectively, used for PCR
were 5′–CCTCGAAATCCCATCACAGT–3′ and 5′– CAGGGTCTTGGTGGAGAAGA–3′ for KDM6B (81 bp fragment),
and 5′–ATTCATAGCAGCGAACAGCC–3′ and 5′–CTGGACAGCCGCCTCTT–3′ for KDM6A (91 bp fragment).
Immunoblotting for JMJD3 and UTX proteins
Cell lysates were collected from asynchronously proliferating cells in buffer (Cell
Signaling) supplemented with proteinase (Roche) and phosphatase (Sigma) inhibitor
cocktails. Lysates were resolved by SDS-PAGE, and detected protein expression as described
above. Antibodies specific for JMJD3 (AP1022a, 1:1,000) was obtained from Abgent,
and UTX antibody (A302-374A, 1:1,000) was from Bethyl.
Analysis of brain-tissue drug concentration
Athymic mice were administered GSKJ4 at 100 mg per kg per day for 3 d, with brains
resected following mouse euthanasia 3 h after the third administration. Brainstem
was dissected from surrounding brain, with tissues snap frozen and stored at −80 °C.
GSKJ4 was extracted from homogenized tissues using a Bullet Blender (Next Advance,
Inc.). Homogenates were extracted with organic solvent and further processed before
transfer to an autosampler for high-performance liquid chromatography (HPLC) analysis
(Shimadzu VP Series 10 System), and determination of GSKJ4 and GSKJ1 content (Integrated
Analytical Systems).
Microarray analyses
RNAs from SF8628 K27M DIPG cells, either untreated or treated with GSKJ4 for 24 and
72 h, were extracted then labeled (Cy3 for treated and Cy5 for untreated). 100-ng
quantities of corresponding treated–untreated pairs were hybridized to SurePrint G3
Human Gene Expression 8 × 60K Microarrays (Agilent Technologies), in duplicate, for
each length of treatment, for 17 h at 65 °C. Subsequent to post-hybridization rinsing,
arrays were scanned using an Agilent Microarray Scanner (model G2505C), and signal
intensities were extracted using Agilent’s Feature Extraction 10.5.1 software. Agilent’s
two-color technology option was used for thresholding of signal values to five, ratio
computing (Cy3/Cy5), and log transformation. No baseline transformation was performed.
Comparison of log2 intensity distributions among all eight samples indicated concordance.
The distribution of Cy3/Cy5 intensity ratios plotted against the average intensity
indicated the absence of bias, i.e. no normalization was necessary.
ChIP-seq
The ChIP-seq experiments were performed as described
3
. Briefly, 1 × 106 cells, treated with vehicle or 6 μM GSKJ4 for 24 and 72 h, were
harvested, washed with PBS and fixed with 1% formaldehyde for 5 min at room temperature.
Cells were then quenched with 125 mM glycine for 5 min. After washing, cell extracts
were prepared using lysis buffer (50 mM HEPES/KOH at pH 7.5, 140 mM NaCl, 1 mM EDTA,
1% Triton-X100, 0.1% Na-deoxycholate, 1 mM PMSF, 1 mM Pefoblock, 1 mM benzamidine,
1 mg/ml bacitracin) on ice for 10 min. Chromatin was sheared by sonication (Bioruptor,
High power, 15 × 2 cycles), to average lengths of 500 bp and then immunoprecipitated
using an antibody against H3K27me3 (#9733, Cell Signaling, 1:50). After repeated washings,
the DNA was recovered from the beads by incubating the beads in elution buffer (10
mM Tris at pH 8.0, 10 mM EDTA at pH 8.0, 1% SDS, 150 mM NaCl, 5 mM DTT) at 65 °C.
Both input DNA and eluted DNA were subsequently purified using Qiagen Mini Elute PCR
purification kit. ChIP DNA libraries were prepared with the Ovation Ultralow DR Multiplex
system (NuGEN). The DNA libraries were sequenced using the paired-end method by an
Illumina Hi-seq 2000. Reads were aligned to the human genome (hg19) using Bowtie2
18
software and preset parameters. Only uniquely mapping reads were used for further
analysis.
Informative tags were selected from the aligned ChIP-seq data of each sequenced sample
based on the cross-correlation profile of positive- and negative-strand tag densities.
Background anomalies resulting from extremely high-density peaks at single chromosome
positions were removed. After these filtering steps, the remaining tag list from each
K27me3-immunoprecipitated sample was normalized against tag lists from sample-matched
input DNA (treated only with DMSO). Broad regions of binding enrichment (i.e. ChIP
signal over input) for each immunoprecipitated sample were obtained by comparing scaled
ChIP and input tag counts to see whether their ratio exceeds that expected from a
Poisson process. The R library SPP
19
was used to perform all aforementioned steps. Distance to the nearest transcription
start site (TSS) was obtained for each enriched binding region using Bioconductor
package ChIPpeakAnno
20
(function annotatePeakInBatch, AnnotationData: TSS.human.GRCh37).
Combined ChIP-seq and gene expression analysis
To identify both, differentially expressed and differentially immunoprecipitated genes,
we derived P values and fold changes separately for differential expression and K27me3
immunoprecipitation as described below.
To identify differential gene expression associated with GSKJ4 treatment, we performed
a t-test to verify the null hypothesis that the Cy3/Cy5 intensity log ratios derived
from GSKJ4-treated cells (24 and 72 h; two replicates per time point) are distinct
from 0. The R package DBChIP was used to identify sequences for which differential
K27me3-immunoprecipitated is associated with GSKJ4 treatment. Enrichment sites estimated
from vehicle-treated SF8628 cells and SF8628 cells incubated with 6 μM GSKJ4 (24 and
72 h) were merged into consensus binding sites (function site.merge), and fold changes
of non-differential binding at each consensus site were calculated (function test.diff.binding).
P values for each gene were obtained by performing a two-sided Wilcoxon signed-rank
test of the hypothesis that fold changes associated with a gene come from a distribution
whose median is 0. The resulting P values reflect both differential length of K27me3
immunoprecipitated regions between GSKJ4-treated and untreated samples, and differential
sequencing depth within those regions. The 34 differentially expressed and differentially
immunoprecipitated genes (P ≤ 0.1 and absolute fold change ≥ 1.5), and for which there
was an inverse correlation between GSKJ4-associated gene expression change and corresponding
change in K27me3 sequence association, are shown in Supplementary Fig. 11 and Supplementary
Table 3.
Supplementary Material
Supplementary information