Novel multi-targeted polymerase chain reaction for diagnosis of presumed tubercular uveitis

There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

Abstract

Background

The objective of this study was to report the use of multi-targeted polymerase chain reaction (PCR) in the diagnosis of presumed tubercular uveitis. Multi-targeted PCR using three targets specific for Mycobacterium tuberculosis, i.e., IS6110, MPB64, and protein b, was performed on intraocular fluid samples of 25 subjects. Nine had presumed tubercular uveitis, six had intraocular inflammation secondary to a nontubercular etiology (disease controls), and ten had no evidence of intraocular inflammation (normal controls). As described previously, response to antitubercular therapy was considered as the gold standard.

Results

Multi-targeted PCR was positive in seven out of nine patients with presumed tubercular uveitis and negative in all normal and disease controls. The sensitivity and specificity were 77.77% and 100%, respectively. For the diagnosis of presumed tubercular uveitis, multi-targeted PCR had a positive predictive value of 100% and a negative predictive value of 88.88%.

Conclusion

Multi-targeted PCR can be a valuable tool for diagnosing presumed tubercular uveitis.

Related collections

Most cited references 25

Record: found
Abstract: found
Article: not found

Intraocular tuberculosis--an update.

Vishali Gupta, Amod Gupta, Narsing A Rao (2007)

The lack of any uniform diagnostic criteria for intraocular tuberculosis, in either immunocompetent or immunocompromised individuals, has contributed to the confusion regarding diagnosis and management. However, recent studies addressing the clinical significance of purified protein derivative test results, computerized tomography of the chest, and molecular diagnostic procedures have provided a new approach to establishing the diagnosis of ocular tuberculosis. The current review focuses on the diagnostic modalities used for the clinical management of intraocular tuberculosis, with the emphasis on diagnostic criteria, various clinical features, and treatments recommended in recent publications. Furthermore, the current review addresses the diagnostic criteria for intraocular tuberculosis, the spectrum of tuberculosis in patients with AIDS and in those on anti-tumor necrosis factor agents, and management of drug-resistant tuberculosis.

0 comments Cited 150 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis.

K D Eisenach, M. Cave, J H Bates … (1990)

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.

0 comments Cited 94 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

Operational feasibility of using loop-mediated isothermal amplification for diagnosis of pulmonary tuberculosis in microscopy centers of developing countries.

Catharina C. Boehme, Pamela Nabeta, German Henostroza … (2007)

The characteristics of loop-mediated isothermal amplification (LAMP) make it a promising platform for the molecular detection of tuberculosis (TB) in developing countries. Here, we report on the first clinical evaluation of LAMP for the detection of pulmonary TB in microscopy centers in Peru, Bangladesh, and Tanzania to determine its operational applicability in such settings. A prototype LAMP assay with simplified manual DNA extraction was evaluated for accuracy and ease of use. The sensitivity of LAMP in smear- and culture-positive sputum specimens was 97.7% (173/177 specimens; 95% confidence interval [CI], 95.5 to 99.9%), and the sensitivity in smear-negative, culture-positive specimens was 48.8% (21/43 specimens; CI, 33.9 to 63.7%). The specificity in culture-negative samples was 99% (500/505 specimens; CI, 98.1 to 99.9%). The average hands-on time for testing six samples and two controls was 54 min, similar to that of sputum smear microscopy. The optimal amplification time was 40 min. No indeterminate results were reported, and the interreader variability was 0.4%. Despite the use of a single room without biosafety cabinets for all procedures, no DNA contamination was observed. The assay was robust, with high end-point stability and low rates of test failure. Technicians with no prior molecular experience easily performed the assay after 1 week of training, and opportunities for further simplification of the assay were identified.

0 comments Cited 89 times – based on 0 reviews      Review now

Bookmark

All references

Author and article information

Contributors

Kusum Sharma

Vishali Gupta

Reema Bansal

Aman Sharma

Meera Sharma

Amod Gupta

Journal

Journal ID (nlm-ta): J Ophthalmic Inflamm Infect

Journal ID (iso-abbrev): J Ophthalmic Inflamm Infect

Title: Journal of Ophthalmic Inflammation and Infection

Publisher: Springer

ISSN (Electronic): 1869-5760

Publication date Collection: 2013

Publication date (Electronic): 28 January 2013

Volume: 3

Page: 25

Affiliations

[1 ]Department of Medical Microbiology, Post Graduate Institute of Medical Education and Research, Chandigarh, 160012, India

[2 ]Department of Ophthalmology and Advanced Eye Centre, Post Graduate Institute of Medical Education and Research, Chandigarh 160012, India

[3 ]Department of Internal Medicine, Post Graduate Institute of Medical Education and Research, Chandigarh, 160012, India

Article

Publisher ID: 1869-5760-3-25

DOI: 10.1186/1869-5760-3-25

PMC ID: 3605072

PubMed ID: 23514226

SO-VID: 97f03864-bd38-48c6-81a3-bc7dc52452f1

License:

This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Novel multi-targeted polymerase chain reaction for diagnosis of presumed tubercular uveitis

Read this article at

Abstract

Background

Results

Conclusion

Related collections

Karger: Ophthalmology

Most cited references 25

Intraocular tuberculosis--an update.

Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis.

Operational feasibility of using loop-mediated isothermal amplification for diagnosis of pulmonary tuberculosis in microscopy centers of developing countries.

Author and article information

Contributors

Journal

Affiliations

Article

History

Categories

Comments

Comment on this article

Similar content 289

Cited by 20

Most referenced authors 309