Infections by the Ebola (EboV) and Marburg (MarV) filoviruses cause a rapidly fatal
hemorrhagic fever in humans for which no approved antivirals are available
1
. Filovirus entry is mediated by the viral spike glycoprotein (GP), which attaches
viral particles to the cell surface, delivers them to endosomes, and catalyzes fusion
between viral and endosomal membranes
2
. Additional host factors in the endosomal compartment are likely required for viral
membrane fusion. However, despite considerable efforts, these critical host factors
have defied molecular identification
3,4,5
. Here we describe a genome-wide haploid genetic screen in human cells to identify
host factors required for EboV entry. Our screen uncovered 67 mutations disrupting
all six members of the HOPS multisubunit tethering complex, which is involved in fusion
of endosomes to lysosomes
6
, and 39 independent mutations that disrupt the endo/lysosomal cholesterol transporter
protein Niemann-Pick C1 (NPC1)
7
. Cells defective for the HOPS complex or NPC1 function, including primary fibroblasts
derived from human Niemann-Pick type C1 disease patients, are resistant to infection
by EboV and MarV, but remain fully susceptible to a suite of unrelated viruses. We
show that membrane fusion mediated by filovirus glycoproteins and viral escape from
the vesicular compartment requires the NPC1 protein, independent of its known function
in cholesterol transport. Our findings uncover unique features of the entry pathway
used by filoviruses and suggest potential antiviral strategies to combat these deadly
agents.
We have developed haploid genetic screens to gain insight into biological processes
relevant to human disease
8,9
. Here we use this approach to explore the filovirus entry pathway at unprecedented
level of detail. To interrogate millions of gene disruption events for defects in
EboV entry, we used a replication-competent vesicular stomatitis virus bearing the
EboV glycoprotein (rVSV-GP-EboV)
10
. Although this virus replicates in most cell lines, it inefficiently killed near-haploid
KBM7 cells (Figure S1C). In an unsuccessful attempt to induce pluripotency in KBM7
cells by expression of OCT4, SOX-2, c-MYC and KLF4
11
, we obtained HAP1 cells (Figure S1A). HAP1 cells grew adherently and no longer expressed
hematopoietic markers (Figure S1B). The majority of these cells in early passage cultures
were haploid for all chromosomes, including chromosome 8 (which is diploid in KBM7
cells). Unlike KBM7 cells, HAP1 cells were susceptible to rVSV-GP-EboV (Figure S1C)
allowing screens for filovirus host factors.
We used a retroviral gene-trap vector
9
to mutagenize early-passage HAP1 cells. To generate a control dataset, we mapped ~800,000
insertions using deep sequencing (Table S1). Next, we selected rVSV-GP-EboV-resistant
cells, expanded them as a pool, and mapped insertion sites. Enrichment for mutations
in genes was calculated by comparing a gene’s mutation frequency in resistant cells
to that in the control dataset (Figure S2). We identified a set of genes enriched
for mutations in the rVSV-GP-EboV-resistant cell population (Figure 1A, S3 and Table
S2). Nearly all of these candidate host factors are involved in the architecture and
trafficking of endo/lysosomal compartments. Gratifyingly, our screen identified cathepsin
B (CatB), the only known host factor whose deletion inhibits EboV entry
5
. Further inspection showed that mutations were highly enriched in all 6 subunits
of the homotypic fusion and vacuole protein-sorting (HOPS) complex (VPS11, VPS16,
VPS18, VPS33A, VPS39 and VPS41), for which we identified 67 independent mutations.
The HOPS complex mediates fusion of endosomes and lysosomes
6
and affects endosome maturation
12,13
. The identification of all members of the HOPS complex demonstrates high, and possibly
saturating, coverage of our screen. We also identified factors involved in biogenesis
of endosomes (PIKFYVE, FIG4)
14
, lysosomes (BLOC1S1, BLOC1S2)
15
, and in targeting of luminal cargo to the endocytic pathway (GNPTAB)
16
. The strongest hit was the Niemann-Pick disease locus NPC1, encoding an endo/lysosomal
cholesterol transporter
7
. NPC1 also affects endosome/lysosome fusion and fission
17
, calcium homeostasis
18
and HIV-1 release
19
.
We subcloned the resistant cell population to obtain clones deficient for VPS11 and
VPS33A, and NPC1 (Figure S4A, B and Figure 1B). These mutants displayed marked resistance
to infection by rVSV-GP-EboV and VSV pseudotyped with EboV or MarV GP (Figure 1C and
Figure S4C). Cells lacking a functional HOPS complex or NPC1 were nonetheless fully
susceptible to infection by a large panel of other enveloped and nonenveloped viruses,
including VSV and recombinant VSV bearing different viral glycoproteins (Figure 1D
and S5). The susceptibility of HAP1 clones to rVSV-GP-EboV infection was restored
by expression of the corresponding cDNAs (Figure S6A, B, C).
Loss of NPC1 causes Niemann-Pick disease, a neurovisceral disorder characterized by
cholesterol and sphingolipid accumulation in lysosomes
7
. We tested susceptibility of patient primary fibroblasts to filovirus GP-dependent
infection. NPC1-mutant cells were infected poorly or not at all by rVSV-GP-EboV and
VSV pseudotyped with filovirus GP proteins (Figure 2A, B), and infection was restored
by expression of wild type NPC1 (Figure 2C).
Mutations in NPC2 cause identical clinical symptoms and phenocopy defects in lipid
transport
20
. Surprisingly, NPC2-mutant fibroblasts derived from different patients were susceptible
to filovirus GP-dependent infection (Figure 2A and Figure S7), despite a similar accumulation
of cholesterol in NPC2- and NPC1-mutant cells (Figure 2B). Moreover, cholesterol clearance
from NPC1-null cells by cultivation in lipoprotein-depleted growth medium did not
confer susceptibility (Figure S8). Therefore, resistance of NPC1-deficient cells to
rVSV-GP-EboV is not caused by defects in cholesterol transport per se.
Filoviruses display broad mammalian host and tissue tropism
21,22
. To determine if NPC1 is generally required for filovirus GP-mediated infection,
we used NPC1-null Chinese hamster ovary (CHO) cells. Loss of NPC1 conferred complete
resistance to viral infection (Figure S6D) that was reversed by expression of human
NPC1 (Figure S6E). Certain small molecules such as U18666A
23
and the antidepressant imipramine
24
cause a cellular phenotype similar to NPC1 deficiency possibly by targeting NPC1
23
. Prolonged U18666A treatment was reported to modestly inhibit VSV
25
. However, we found that brief exposure of Vero cells and HAP1 cells to U18666A or
imipramine potently inhibited viral infection mediated by EboV GP but not VSV or rabies
virus G (Figure 2D, S9, and S10). Because U18666A inhibits rVSV-GP-EboV infection
only when added at early time points, it likely affects entry rather than replication
(Figure S10). Thus, NPC1 has a critical role in infection mediated by filovirus glycoproteins
that is conserved in mammals and likely independent of NPC1’s role in cholesterol
transport.
Filoviruses bind to one or more cell-surface molecules
2,26,27
and are internalized by macropinocytosis
28,29
. In VPS33A- and NPC1-mutant cells, we observed no significant differences in binding
or internalization of Alexa 647-labeled rVSV-GP-EboV (Figure 3A, Figure S11 and Figure
S12A). Similar results were obtained by flow cytometry using fluorescent EboV virus-like
particles (Figure S12B). Moreover, bullet-shaped VSV particles were readily observed
by electron microscopy at the cell periphery and within plasma membrane invaginations
resembling nascent macropinosomes (Figure 3B). Finally, VPS33A- and NPC1-null cells
were fully susceptible to vaccinia virus entry by macropinocytosis (Figure S13). Thus,
GP-mediated entry is not inhibited at viral attachment or early internalization steps
in NPC1- or HOPS-defective cells, suggesting a downstream defect.
Cathepsin L (CatL)-assisted cleavage of EboV GP by CatB is required for viral membrane
fusion
3,5
. Mutant HAP1 cells possess normal CatB/CatL activity (Figure S14B, C) and were fully
susceptible to mammalian reoviruses, which utilize CatB or CatL for entry (Fig. S14D).
Moreover, these cells remained refractory to in vitro-cleaved rVSV-GP-EboV particles
(Figure 3C) that no longer required CatB/CatL activity within Vero cells (Figure S14A).
Therefore the HOPS complex and NPC1 are likely required downstream of the initial
GP proteolytic processing steps that generate a primed entry intermediate.
Finally, we used the intracellular distribution of the internal VSV M (matrix) protein
as a marker for membrane fusion (Figure 3D). Cells were infected with native VSV or
rVSV-GP-EboV and immunostained to visualize the incoming M protein. Endosomal acid
pH-dependent entry of either virus into wild type HAP1 cells caused redistribution
of the incoming viral M throughout the cytoplasm (Figure 3D) (Figure S15A). By contrast,
only punctate, perinuclear M staining was obtained in drug-treated and mutant cells
infected with rVSV-GP-EboV or rVSV-GP-MarV (Figure 3D and Figure S15B). Electron micrographs
of mutant cells infected with rVSV-GP-EboV revealed agglomerations of viral particles
within vesicular compartments (Figure 3E and S16A) containing LAMP-1 (Figure S16B),
suggesting that fusion and uncoating of incoming virus is arrested. Similarly, U18666A
treatment increased the number of viral particles in NPC1-and LAMP1-positive endosomes
(Figure S17). Therefore, NPC1 and the HOPS complex are required for late step(s) in
filovirus entry leading to viral membrane fusion and escape from the lysosomal compartment.
We next tested if infection by authentic EboV and MarV is affected in NPC1-mutant
primary patient fibroblasts. Yields of viral progeny were profoundly reduced for both
viruses in mutant cells (Figure 4A). Stark reductions in viral yield were also obtained
in Vero cells treated with U18666A (Figure 4B). Moreover U18666A greatly reduced infection
of human peripheral blood monocyte-derived dendritic cells and umbilical-vein endothelial
cells (HUVEC) (Figure 4C), without affecting cell number or morphology (Figure S19).
Finally, knockdown of NPC1 in HUVEC diminished infection by filoviruses (Figure 4D
and S18). These findings indicate that NPC1 is critical for authentic filovirus infection.
We assessed the effect of NPC1 mutation in lethal mouse models of EboV and MarV infection.
Heterozygous NPC1 (NPC1−/+) knockout mice and their wild type littermates were challenged
with mouse-adapted EboV or MarV and monitored for 28 days. Whereas NPC1+/+ mice rapidly
succumbed to infection with either filovirus, NPC1−/+ mice were largely protected
(Figure 4E).
We have used global gene disruption in human cells to discover components of the unusual
entry pathway used by filoviruses. Most of the identified genes affect aspects of
lysosome function, suggesting that filoviruses exploit this organelle differently
from all other viruses that we have tested (Figure 4F). The unanticipated role for
the hereditary disease gene NPC1 in viral entry, infection, and pathogenesis may facilitate
the development of anti-filovirus therapeutics.
Methods Summary
Adherent HAP1 cells were generated by the introduction of OCT4/SOX2/c-Myc and KLF4
transcription factors. 100 million cells were mutagenized using a retroviral gene-trap
vector. Insertion sites were mapped for approximately 1% of the unselected population
using parallel sequencing. Cells were infected with rVSV-GP-EboV and the resistant
cell population was expanded. Genes that were statistically enriched for mutation
events in the selected population were identified, and the roles of selected genes
in filovirus entry were characterized.
Methods online
Cells
KBM7 cells and derivatives were maintained in IMDM supplemented with 10% FCS, L-glutamine,
and penicillin streptomycin. Vero cells and primary human dermal fibroblasts (Coriell
Institute for Medical Research) were maintained in DMEM supplemented with 10% FCS,
L-glutamine, and penicillin streptomycin. Wild type and NPC1-null (CT43) Chinese hamster
ovary (CHO) fibroblasts were maintained in DMEM-Ham’s F-12 medium (50–50 mix) supplemented
with 10% FCS, L-glutamine, and penicillin streptomycin
30
.
To generate dendritic cells (DC), primary human monocytes were cultured at 37°C, 5%
CO2, and 80% humidity in RPMI supplemented with 10% human serum, L-glutamine, sodium
pyruvate, HEPES, penicillin-streptomycin, recombinant human granulocyte monocyte-colony
stimulating factor (50 ng/ml) and recombinant human interleukin-4 (50 ng/ml)) for
6 days. Cytokines were added every two days by replacing half of the culture volume
with fresh culture media. DC were collected on day 6, characterized by flow cytometry
(see below) and utilized immediately. Human umbilical vein endothelial cells (HUVEC)
were obtained from Lonza (Walkersville, MD) and maintained in endothelial grown medium
(EGM; Lonza).
HAP1 cells were used for the haploid screen and fibroblasts or CHO cells were used
for hit validation and functional studies. Vero cells are commonly used in studies
of filovirus replication, because they are highly susceptible to infection. DC and
HUVEC resemble cell types that are early and late targets of filovirus infection in
vivo, respectively
31,32
.
Flow cytometry of DC
Human DC were treated with Fc-block (BD Pharmingen) prior to incubation with mouse
anti-human CD11c-APC (BioLegend) and mouse anti-human CD209-PE or isotype controls.
DC were washed and resuspended in PBS for flow cytometric analysis using a BD FACSCanto
II flow cytometer (BD Biosciences). Data analysis was completed using FlowJo software.
>95% of cells were routinely observed to be CD11c+, DC-SIGN+.
Viruses
Recombinant VSV expressing eGFP and EboV GP (rVSV-GP-EboV) was recovered and amplified
as described
10
. Recombinant rVSV-GP-BDV was generously provided by Juan Carlos de la Torre. rVSV-G-RABV
was generated by replacement of the VSV G ORF in VSV-eGFP
33
with that of the SAD-B19 strain of rabies virus, and recombinant virus was recovered
and amplified
34
. VSV pseudotypes bearing glycoproteins derived from EboV, Sudan virus, and MarV were
generated as described
35
.
The following non-recombinant viruses were used: Adenovirus type 5 (ATCC), Coxsackievirus
B1 (ATCC), Poliovirus 1 Mahoney (generously provided by Christian Schlieker), HSV-1
KOS (generously provided by Hidde Ploegh), Influenza A/PR8/34 (H1N1) (Charles Rivers),
Rift valley fever virus MP-12 (generously provided by Jason Wojcechowskyj), and mammalian
reovirus serotype 1, (generously provided by Max Nibert).
Generation of HAP1 cells
Retroviruses encoding SOX2, C-MYC, OCT4 and KLF4 were produced
36
. Concentrated virus was used to infect near haploid KBM7 cells in three consecutive
rounds of spin-infection with an interval of 12 hours. Colonies were picked and tested
for ploidy. One clonally derived cell line (referred to as HAP1) was further grown
and characterized. Karyotyping analysis demonstrated that the majority of the cells
(27/39) were fully haploid, a smaller population (9/39) was haploid for all chromosomes
except chromosome 8, like the parental KBM7 cells. Less than 10% (3/39) was diploid
for all chromosomes except for chromosome 8 that was tetraploid.
Haploid genetic screen
Gene trap virus was produced in 293T cells by transfection of pGT-GFP, pGT-GFP+1 and
pGT-GFP+2 combined with pAdvantage, CMV-VSVG and Gag-pol. The virus was concentrated
using ultracentrifugation for 1.5 h at 25,000 r.p.m. in a Beckman SW28 rotor. 100
million HAP1 cells were infected. A proportion of the cells was harvested for genomic
DNA isolation to create a control dataset. For the screen, 100 million mutagenized
cells were exposed to rVSV-GP-EboV at an MOI ~100. The resistant colonies were expanded
and ~30 million cells were used for genomic DNA isolation.
Sequence analysis of gene trap insertion sites
Insertion sites were identified by sequencing the genomic DNA flanking gene trap proviral
DNA as described before
8
. In short, a control dataset was generated containing insertion sites in mutagenized
HAP1 cells before selection with rVSV-GP-EboV. Genomic DNA was isolated from ~40 million
cells and subjected to a linear PCR followed by linker ligation, PCR and sequencing
using the Genome Analyzer platform (Illumina). Insertions sites were mapped to the
human genome and insertion sites were identified that were located in Refseq genes.
Insertions in this control dataset comprise of ~400,000 independent insertions that
meet this criteria (Table S1). To generate the experimental dataset, insertions in
the mutagenized HAP1 cells after selection with rVSV-GP-EboV were identified using
an inverse PCR protocol followed by sequencing using the Genome Analyzer. The number
of inactivating mutations (i.e. sense orientation or present in exon) per individual
gene was counted as well as the total number of inactivating insertions for all genes.
Enrichment of a gene in the screen was calculated by comparing how often that gene
was mutated in the screen compared to how often the genes carries an insertion in
the control dataset. For each gene a p-value (corrected for false discovery rate)
was calculated using the one-sided Fisher exact test (Table S2).
Characterization of the HAP1 mutant lines
Genomic DNA was isolated using Qiamp DNA mini kit (Qiagen). To confirm that the cells
were truly clonal and to confirm the absence of the wild type DNA locus, a PCR was
performed with primers flanking the insertion site using the following primers: (NPC-F1,
5′-GAAGTTGGTCTGGCGATGGAG-3′; NPC1-R2, 5′-AAGGTCCTGATCTAAAACTCTAG-3′; VPS 33 A–F 1,
5′-TGTCCTACGGCCGAGTGAACC-3′; VPS 33 A–R 1, 5′-CTGTACACTTTGCTCAGTTTCC-3′; VPS 11-F
1, 5′-GAAGGAGCCGCTGAGCAATGATG-3′; VPS 11-R 1, 5′-GGCCAGAATTTAGTAGCAGCAAC-3′. To confirm
the correct insertion of the gene trap at the different loci a PCR was performed using
the reverse (R1) primers of NPC1, VPS11 and VPS33A combined with a primer specific
for the gene trap vector: PGT-F1; 5′-TCTCCAAATCTCGGTGGAAC-3′. To determine RNA expression
levels of NPC1, VPS11 and VPS33A, total RNA was reverse transcribed using Superscript
III (Invitrogen) and amplified using gene specific primers: (VPS 11: 5′-CTGCTTCCAAGTTCCTTTGC-3′
a n d 5′-AAGATTCGAGTGCAGAGTGG-3′; NPC1: 5′-CCACAGCATGACCGCTC-3′ and 5′-CAGCTCACAAAACAGGTTCAG-3′;
VPS 33 A: 5′-TTAACACCTCTTGCCACTCAG-3′ and 5′-TGTGTCTTTCCTCGAATGCTG-3′.
Generation of stable cell populations expressing an NPC1-FLAG fusion protein
A human cDNA endoding NPC1 (Origene) was ligated in-frame to a triple FLAG sequence
and the resulting gene encoding a C-terminally FLAG-tagged NPC1 protein was subcloned
into the pBABE-puro retroviral vector
37
. Retroviral particles packaging the NPC1-FLAG gene or no insert were generated by
triple transfection in 293T cells, and used to infect control and NPC1-deficient human
fibroblasts and CHO lines. Puromycin-resistant stable cell populations were generated.
Cell viability assays for virus treatments
KBM7 and HAP1 cells were seeded at 10,000 cells per well in 96-well tissue culture
plates and treated with the indicated concentrations of rVSV-GP-EboV. After three
days cell viability was measured using an XTT colorimetric assay (Roche). Viability
is plotted as percentage viability compared to untreated control. To compare susceptibility
of the HAP1 mutants to different viruses, they were seeded at 10,000 cells per well
and treated with different cytolytic viruses at a concentration that in pilot experiments
was the lowest concentration to produce extensive cytopathic effects. Three days after
treatment, viable, adherent cells were fixed with 4% formaldehyde in phosphate-buffered
saline (PBS) and stained with crystal violet.
VSV infectivity measurements
Infectivities of VSV pseudotypes were measured by manual counting of eGFP-positive
cells using fluorescence microscopy at 16–26 h post-infection, as described previously
5
. rVSV-GP-EboV infectivity was measured by fluorescent-focus assay (FFA), as described
previously
10
.
Filipin staining
Filipin staining to visualize intracellular cholesterol was done as described
38
. Cells were fixed with paraformaldehyde (3%) for 15 min at room temperature (RT).
After three PBS washes, cells were incubated with filipin complex from Streptomyces
filipinensis (Sigma-Aldrich) (50 μg/mL) in the dark for 1 h at RT. After three PBS
washes, cells were visualized by fluorescence microscopy in the DAPI channel.
Measurements of cysteine cathepsin activity
Enzymatic activities of CatB and CatL in acidified postnuclear extracts of Vero cells,
human fibroblasts, and CHO lines were assayed with fluorogenic peptide substrates
Z-Arg-Arg-AMC (Bachem Inc., Torrance, CA) and (Z-Phe-Arg)2-R110 (Invitrogen) as described
39
. As a control for assay specificity, enzyme activities were also assessed in extracts
pretreated with E-64 (10 μM), a broad-spectrum cysteine protease inhibitor, as previously
described
10
. Active CatB and CatL within intact cells were labeled with the fluorescently-labeled
activity-based probe GB111 (1 μM) and visualized by gel electrophoresis and fluorimaging,
as described previously
40
.
Purification and dye conjugation of rVSV-GP-EboV
rVSV-GP-EboV was purified and labeled with Alexa Fluor 647 (Molecular Probes, Invitrogen
Corporation) as described
41
with minor modifications. Briefly, Alexa Fluor 647 (Molecular Probes, Invitrogen Corporation)
was solubilized in DMSO at 10 mg/mL and incubated at a concentration of 31.25 μg/ml
with purified rVSV-GP-EboV (0.5 mg/ml) in 0.1 M NaHCO3 (pH 8.3) for 90 min at RT.
Virus was separated from free dye by ultracentrifugation. Labeled viruses were resuspended
in NTE (10 mM Tris pH 7.4, 100 mM NaCl, 1 mM EDTA) and stored at −80°C.
Virus binding/internalization assay
Cells were inoculated with an MOI of 200–500 of Alexa 647-labeled rVSV-GP-EboV at
4°C for 30 min to allow binding of virus to the cell surface. Cells were subsequent
fixed in 2% paraformaldehyde (to examine virus binding) or following a 2 h incubation
at 37°C and an acid wash to remove surface-bound virus. The cellular plasma membrane
was labeled by incubation of cells with 1 μg/mL Alexa Fluor 594 wheat germ agglutinin
(Molecular Probes, Invitrogen) in PBS for 15 min at RT. External virus particles were
detected using a 1:2000 dilution of antibody 265.1, a mouse monoclonal specific for
Ebola GP. The GP antibodies were detected by Alexa 488-conjugated goat anti-mouse
secondary antibody (Molecular Probes, Invitrogen). After washing with PBS, cells were
mounted onto glass slides using Prolong Antifade Reagent (Invitrogen, Molecular Probes).
Fluorescence was monitored with a epifluorescence microscope (Axiovert 200M; Carl
Zeiss, Inc.; Thornwood, NY) and representative images were acquired using Slidebook
4.2 software (Intelligent Imaging Innovations; Denver, CO)
41,42
.
VSV M protein-release assay
Cells grown on 12 mm coverslips coated with poly-D-lysine (Sigma-Aldrich) were pre-treated
with 5 μg/ml puromycin for 30 min and inoculated with rVSV at an MOI of 200–500 in
the presence of puromycin. After 3 h, cells were washed once with PBS and fixed with
2% paraformaldehyde in PBS for 15 min at RT. To detect VSV M protein, fixed cells
were incubated with a 1:7500 dilution of monoclonal antibody 23H12 (kind gift of Doug
Lyles
43
), in PBS containing 1% BSA and 0.1 % Triton X-100 for 30 min at RT. Cells were washed
three times with PBS, and the anti-M antibodies were detected using a 1:750 dilution
of Alexa 594-conjugated goat anti-mouse secondary antibodies. Cells were counter-stained
with DAPI to visualize nuclei. Cells were washed three times and mounted onto glass
slides after which M localization images were acquired using a Nikon TE2000-U inverted
epifluorescence microscope (Nikon Instruments, Inc.; Melville, NY). Representative
images were acquired with Metamorph software (Molecular Devices).
Electron microscopy
Confluent cell monolayers in 6-well plates were inoculated with rVSV-GP-EboV at a
MOI of 200–500 for 3 h. Cells were fixed for at least 1 h at RT in a mixture of 2.5%
glutaraldehyde, 1.25% paraformaldehyde and 0.03% picric acid in 0.1 M sodium cacodylate
buffer (pH 7.4). Samples were washed extensively in 0.1 M sodium cacodylate buffer
(pH 7.4) and treated with 1% osmiumtetroxide and 1.5% potassiumferrocyanide in water
for 30 min at RT. Treated samples were washed in water, stained in 1% aqueous uranyl
acetate for 30 min, and dehydrated in grades of alcohol (70%, 90%, 2×100%) for 5 min
each. Cells were removed from the dish with propyleneoxide and pelleted at 3,000 rpm
for 3 min. Samples were infiltrated with Epon mixed with propyleneoxide (1:1) for
2 h at RT. Samples were embedded in fresh Epon and left to polymerize for 24–48 h
at 65°C. Ultrathin sections (about 60–80 nm) were cut on a Reichert Ultracut-S microtome
and placed onto copper grids. For preparation of cryosections the virus-inoculated
cells were rinsed once with PBS and removed from the dish with 0.5 mM EDTA in PBS.
The cell suspension was layered on top of an 8% paraformaldehyde cushion in an eppendorf
tube and pelleted for 3 min at 3.000 rpm. The supernatant was removed and fresh 4%
paraformaldehyde was added. After 2 h incubation, the fixative was replaced with PBS.
Prior to freezing in liquid nitrogen the cell pellets were infiltrated with 2.3 M
sucrose in PBS for 15 min. Frozen samples were sectioned at −120°C and transferred
to formvar-carbon coated copper grids. Grids were stained for lysosomes with a mouse
monoclonal antibody raised against LAMP1 (H4A3; Santa Cruz Biotechnology, Inc.). The
LAMP1 antibodies were visualized with Protein-A gold secondary antibodies. Contrasting/embedding
of the labeled grids was carried out on ice in 0.3% uranyl acetete in 2% methyl cellulose.
All grids were examined in a TecnaiG2 Spirit BioTWIN mission electron microscope and
images were recorded with an AMT 2k CCD camera.
Authentic filoviruses and infections
Vero cells were pretreated with culture medium lacking or containing U18666A (20 μM)
for 1 h at 37°C. VERO cells and primary human dermal fibroblasts were exposed to EboV-Zaire
1995 or MarV-Ci67 at an MOI of 0.1 for 1 h. Viral inoculum was removed and fresh culture
media with or without drug was added. Samples of culture supernatants were collected
and stored at −80°C until plaque assays were completed.
DC were collected and seeded in 96-well poly-d-lysine coated black plates (Greiner
Bio-One) at 5×104 cells per well or in 6 well plates at 106 cells per well in culture
media and incubated overnight at 37°C. They were pretreated with medium lacking or
containing U18666A as described above. DC were exposed to EboV-Zaire 1995 or MarV-Ci67
at an MOI of 3 for 1 h. Virus inoculum was removed and fresh culture media with or
without drug was added. Uninfected cells with or without drug served as negative controls.
Cells were incubated at 37°C and fixed with 10% formalin at designated times. HUVEC
were seeded in 96-well poly-d-lysine coated black plates at 5 × 104 cells per well
in culture media, treated with U18666A, infected, and processed as described above
for DC.
Cytotoxicity analysis
DC and HUVEC were seeded in 96-well plates. Following overnight incubation at 37°C,
U18666A was added at the same concentrations used for the viral infection studies.
Cells in culture media without drug served as the untreated control. At indicated
times post treatment, an equal volume of Cell Titer-Glo Reagent (Promega) was added
to wells containing cells in culture media. Luminescence was measured using a plate
reader.
Plaque assays for titration of filoviruses
Tenfold serial dilutions of culture supernatants or serum were prepared in modified
Eagle medium with Earle’s balanced salts and nonessential amino acids (EMEM/NEAA)
plus 5% heat -inactivated fetal bovine serum. Each dilution was inoculated into a
well of a 6-well plate containing confluent monolayers of Vero 76 cells. After adsorption
for 1 hour at 37°C monolayers were overlaid with a mixture of 1 part of 1% agarose
(Seakem) and 1 part of 2X Eagle basal medium (EBME), 30mM Hepes buffer and 5% heat-
inactivated fetal bovine serum. Following incubation at 37°C, 5% CO2, 80% humidity
for 6 days, a second overlay with 5% Neutral Red was added. Plaques were counted the
following day, and titers were expressed as PFU/ml.
Analysis of filovirus-infected cultures by immunofluorescence
Formalin-fixed cells were blocked with 1% bovine serum albumin solution prior to incubation
with primary antibodies. EboV-infected cells and uninfected controls were incubated
with EboV GP-specific monoclonal antibodies 13F6
44
or KZ52
45
. MarV-infected cells and uninfected controls were incubated with MarV GP-specific
monoclonal antibody 9G4. Cells were washed with PBS prior to incubation with either
goat anti-mouse IgG or goat anti-human IgG conjugated to Alexa 488. Cells were counterstained
with Hoechst stain (Molecular Probes®), washed with PBS and stored at 4°C.
Image analysis
Images were acquired at 9 fields/well with a 10× objective lens on a Discovery-1 high
content imager (Molecular Devices) or at 6 fields/well with a 20× objective lens on
an Operetta (Perkin Elmer) high content device. Discovery-1 images were analyzed with
the “live/dead” module in MetaXpress software. Operetta images were analyzed with
a customized scheme built from image analysis functions present in Harmony software.
Animals and filovirus challenge experiments
Mouse-adapted EboV has been described
46
. Mouse-adapted MarV Ci67 was provided by Sina Bavari
47
. Female and male BALB/c NPC1+/− mice and BALB/c NPC1 +/+ mice (5 to 8 week old) were
obtained from Jackson Laboratory (Bar Harbor, ME). Mice were housed under specific-pathogen-free
conditions. Research was conducted in compliance with the Animal Welfare Act and other
federal statutes and regulations relating to animals and experiments involving animals
and adhered to principles stated in the Guide for the Care and Use of Laboratory Animals
(National Research Council, 1996). The facility where this research was conducted
is fully accredited by the Association for the Assessment and Accreditation of Laboratory
Animal Care International. For infection, mice were inoculated i.p. with a target
dose of 1000 pfu (30,000 X the 50% lethal dose) of mouse-adapted EboV or mouse-adapted
MarV Ci67 virus in a biosafety level 4 laboratory. Mice were observed for 28 days
after challenge by study personnel and by an impartial third party. Daily observations
included evaluation of mice for clinical symptoms such as reduced grooming, ruffled
fur, hunched posture, subdued response to stimulation, nasal discharge, and bleeding.
Serum was collected from surviving mice to confirm virus clearance. Back titration
of the challenge dose by plaque assay determined that EboV-infected mice received
900 pfu/mouse and MarV-infected mice received 700 pfu/mouse.
RNA interference
Lentiviral vectors expressing an shRNA specific for NPC1 (Sigma-Aldrich; clone# TRCN0000005428;
sequence CCACAAGTTCTATACCATATT) or a nontargeting control shRNA (Sigma-Aldrich; SHC002;
sequence CAACAAGATGAAGAGCACCAA) were packaged into HIV-1 pseudotype virus by transfection
in HEK-293T cells and lentivirus-containing supernatants were harvested at 36h and
48 h post-transfection and centrifuged onto HUVEC in 12-well plates in the presence
of 6 μg/mL polybrene at 2500 rpm, 25°C for 90 min. HepG2 cells were transduced as
above but without the centrifugation step. Cells were subjected to puromycin selection
24 h after the last lentiviral transduction (HepG2, 1 μg/mL; HUVEC, 1.5 μg/mL) for
48–72 h prior to harvest for experiments. The level of NPC1 knockdown was assessed
by SDS-polyacrylamide gel electrophoresis of cell extracts and immunoblotting with
an α-NPC1 polyclonal antibody (Abcam).
EboV Replicon Assay
EboV support plasmids were created by cloning the NP, VP35, VP30 and L genes from
cDNA (generously provided by Elke Mühlberger
48
) into pGEM3 (Promega) and the mutant pL-D742A plasmid was generated by Quik-Change
site-directed mutagenesis (Stratagene). Truncated versions of the EboV non-coding
sequence were generated by overlap-extension PCR and appended to the eGFP ORF. The
replicon pZEm was prepared as described previously
49
. The replicon RNA sequence is flanked on the 5′ end by a truncated T7 promoter with
a single guanosine nucleotide and on the 3′ end by the HDV ribozyme sequence and T7
terminator. The transcribed replicon RNA consists of the following EboV Zaire sequences
(Genbank accession AF086833): [5′] – single guanosine nt −176 nt genomic 5′ terminus
– 55 nt L mRNA 3′ UTR – eGFP ORF (antisense orientation) – 100 nt NP mRNA 5′ UTR –
155 nt genomic 3′ terminus [3′]. The viral replicon assay was performed as described
previously
49
except that U18666A (20 μg/mL) was included in the supplemented DMEM where indicated.
Images were collected directly from 6-cm dishes with a Zeiss Axioplan inverted fluorescent
microscope.
Supplementary Material
1
2
3
4
5
6