- Record: found
- Abstract: found
- Article: not found
Factors enhancing the transmission of mosquito-borne arboviruses in Africa
review-article
Author(s):
Sandra Ateutchia Ngouanet
1
,
2 ,
Samuel Wanji
2 ,
Anges Yadouleton
3 ,
Maurice Demanou
4 ,
Rousseau Djouaka
1 ,
Ferdinand Nanfack-Minkeu
1
,
5
,
Publication date (Electronic):
18 October 2022
Journal:
VirusDisease
Publisher:
Springer India
Read this article at
There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.
Abstract
Arthropod-borne viruses (Arboviruses) replicate in vertebrates and invertebrates and are mainly transmitted by mosquitoes. Between 2000 and 2021, several arbovirus outbreaks were recorded in African countries, including dengue, yellow fever, Chikungunya, Zika, and O’nyong nyong. Most often, the causes and factors involved in these outbreaks are unknown. We aimed to understand current knowledge regarding factors responsible for the persistent transmission and emergence of mosquito-borne arboviruses in Africa and to identify critical research gaps important for preventing future outbreaks. We used a systematic literature review between 2020 and 2021, to show that the main identified factors favoring the arbovirus outbreak in Africa are low vaccination coverage, high density and diversity of competent mosquitoes, insecticide resistance of mosquito vectors, and a scarcity of data on arboviruses. Further studies on arboviruses may include studies of competence to viral strains and the susceptibility of mosquito vectors to insecticides. Because of the detrimental effects of insecticides on human health and the environment, viral paratransgenesis and other biological control methods should be explored as alternatives or as supplements to insecticides.
Graphical abstract
Illustration of factors identified for promoting the transmission of arbovirus in Africa. The main factors are the lack of drugs and vaccines, low coverage of vaccination when a vaccine exists, competence of mosquitoes to viruses, diversity and high density of vectors. Climate change, urbanization, deforestation and agricultural practices, lead to a richness and high density of vectors.
Related collections
Most cited references78
- Record: found
- Abstract: found
- Article: found
Preferred Reporting Items for Systematic Reviews and Meta-Analyses: The PRISMA Statement
David Moher, Alessandro Liberati, Jennifer Tetzlaff … (2017)
Introduction Systematic reviews and meta-analyses have become increasingly important in health care. Clinicians read them to keep up to date with their field [1],[2], and they are often used as a starting point for developing clinical practice guidelines. Granting agencies may require a systematic review to ensure there is justification for further research [3], and some health care journals are moving in this direction [4]. As with all research, the value of a systematic review depends on what was done, what was found, and the clarity of reporting. As with other publications, the reporting quality of systematic reviews varies, limiting readers' ability to assess the strengths and weaknesses of those reviews. Several early studies evaluated the quality of review reports. In 1987, Mulrow examined 50 review articles published in four leading medical journals in 1985 and 1986 and found that none met all eight explicit scientific criteria, such as a quality assessment of included studies [5]. In 1987, Sacks and colleagues [6] evaluated the adequacy of reporting of 83 meta-analyses on 23 characteristics in six domains. Reporting was generally poor; between one and 14 characteristics were adequately reported (mean = 7.7; standard deviation = 2.7). A 1996 update of this study found little improvement [7]. In 1996, to address the suboptimal reporting of meta-analyses, an international group developed a guidance called the QUOROM Statement (QUality Of Reporting Of Meta-analyses), which focused on the reporting of meta-analyses of randomized controlled trials [8]. In this article, we summarize a revision of these guidelines, renamed PRISMA (Preferred Reporting Items for Systematic reviews and Meta-Analyses), which have been updated to address several conceptual and practical advances in the science of systematic reviews (Box 1). Box 1: Conceptual Issues in the Evolution from QUOROM to PRISMA Completing a Systematic Review Is an Iterative Process The conduct of a systematic review depends heavily on the scope and quality of included studies: thus systematic reviewers may need to modify their original review protocol during its conduct. Any systematic review reporting guideline should recommend that such changes can be reported and explained without suggesting that they are inappropriate. The PRISMA Statement (Items 5, 11, 16, and 23) acknowledges this iterative process. Aside from Cochrane reviews, all of which should have a protocol, only about 10% of systematic reviewers report working from a protocol [22]. Without a protocol that is publicly accessible, it is difficult to judge between appropriate and inappropriate modifications. Conduct and Reporting Research Are Distinct Concepts This distinction is, however, less straightforward for systematic reviews than for assessments of the reporting of an individual study, because the reporting and conduct of systematic reviews are, by nature, closely intertwined. For example, the failure of a systematic review to report the assessment of the risk of bias in included studies may be seen as a marker of poor conduct, given the importance of this activity in the systematic review process [37]. Study-Level Versus Outcome-Level Assessment of Risk of Bias For studies included in a systematic review, a thorough assessment of the risk of bias requires both a “study-level” assessment (e.g., adequacy of allocation concealment) and, for some features, a newer approach called “outcome-level” assessment. An outcome-level assessment involves evaluating the reliability and validity of the data for each important outcome by determining the methods used to assess them in each individual study [38]. The quality of evidence may differ across outcomes, even within a study, such as between a primary efficacy outcome, which is likely to be very carefully and systematically measured, and the assessment of serious harms [39], which may rely on spontaneous reports by investigators. This information should be reported to allow an explicit assessment of the extent to which an estimate of effect is correct [38]. Importance of Reporting Biases Different types of reporting biases may hamper the conduct and interpretation of systematic reviews. Selective reporting of complete studies (e.g., publication bias) [28] as well as the more recently empirically demonstrated “outcome reporting bias” within individual studies [40],[41] should be considered by authors when conducting a systematic review and reporting its results. Though the implications of these biases on the conduct and reporting of systematic reviews themselves are unclear, some previous research has identified that selective outcome reporting may occur also in the context of systematic reviews [42]. Terminology The terminology used to describe a systematic review and meta-analysis has evolved over time. One reason for changing the name from QUOROM to PRISMA was the desire to encompass both systematic reviews and meta-analyses. We have adopted the definitions used by the Cochrane Collaboration [9]. A systematic review is a review of a clearly formulated question that uses systematic and explicit methods to identify, select, and critically appraise relevant research, and to collect and analyze data from the studies that are included in the review. Statistical methods (meta-analysis) may or may not be used to analyze and summarize the results of the included studies. Meta-analysis refers to the use of statistical techniques in a systematic review to integrate the results of included studies. Developing the PRISMA Statement A three-day meeting was held in Ottawa, Canada, in June 2005 with 29 participants, including review authors, methodologists, clinicians, medical editors, and a consumer. The objective of the Ottawa meeting was to revise and expand the QUOROM checklist and flow diagram, as needed. The executive committee completed the following tasks, prior to the meeting: a systematic review of studies examining the quality of reporting of systematic reviews, and a comprehensive literature search to identify methodological and other articles that might inform the meeting, especially in relation to modifying checklist items. An international survey of review authors, consumers, and groups commissioning or using systematic reviews and meta-analyses was completed, including the International Network of Agencies for Health Technology Assessment (INAHTA) and the Guidelines International Network (GIN). The survey aimed to ascertain views of QUOROM, including the merits of the existing checklist items. The results of these activities were presented during the meeting and are summarized on the PRISMA Web site (http://www.prisma-statement.org/). Only items deemed essential were retained or added to the checklist. Some additional items are nevertheless desirable, and review authors should include these, if relevant [10]. For example, it is useful to indicate whether the systematic review is an update [11] of a previous review, and to describe any changes in procedures from those described in the original protocol. Shortly after the meeting a draft of the PRISMA checklist was circulated to the group, including those invited to the meeting but unable to attend. A disposition file was created containing comments and revisions from each respondent, and the checklist was subsequently revised 11 times. The group approved the checklist, flow diagram, and this summary paper. Although no direct evidence was found to support retaining or adding some items, evidence from other domains was believed to be relevant. For example, Item 5 asks authors to provide registration information about the systematic review, including a registration number, if available. Although systematic review registration is not yet widely available [12],[13], the participating journals of the International Committee of Medical Journal Editors (ICMJE) [14] now require all clinical trials to be registered in an effort to increase transparency and accountability [15]. Those aspects are also likely to benefit systematic reviewers, possibly reducing the risk of an excessive number of reviews addressing the same question [16],[17] and providing greater transparency when updating systematic reviews. The PRISMA Statement The PRISMA Statement consists of a 27-item checklist (Table 1; see also Text S1 for a downloadable Word template for researchers to re-use) and a four-phase flow diagram (Figure 1; see also Figure S1 for a downloadable Word template for researchers to re-use). The aim of the PRISMA Statement is to help authors improve the reporting of systematic reviews and meta-analyses. We have focused on randomized trials, but PRISMA can also be used as a basis for reporting systematic reviews of other types of research, particularly evaluations of interventions. PRISMA may also be useful for critical appraisal of published systematic reviews. However, the PRISMA checklist is not a quality assessment instrument to gauge the quality of a systematic review. 10.1371/journal.pmed.1000097.g001 Figure 1 Flow of information through the different phases of a systematic review. 10.1371/journal.pmed.1000097.t001 Table 1 Checklist of items to include when reporting a systematic review or meta-analysis. Section/Topic # Checklist Item Reported on Page # TITLE Title 1 Identify the report as a systematic review, meta-analysis, or both. ABSTRACT Structured summary 2 Provide a structured summary including, as applicable: background; objectives; data sources; study eligibility criteria, participants, and interventions; study appraisal and synthesis methods; results; limitations; conclusions and implications of key findings; systematic review registration number. INTRODUCTION Rationale 3 Describe the rationale for the review in the context of what is already known. Objectives 4 Provide an explicit statement of questions being addressed with reference to participants, interventions, comparisons, outcomes, and study design (PICOS). METHODS Protocol and registration 5 Indicate if a review protocol exists, if and where it can be accessed (e.g., Web address), and, if available, provide registration information including registration number. Eligibility criteria 6 Specify study characteristics (e.g., PICOS, length of follow-up) and report characteristics (e.g., years considered, language, publication status) used as criteria for eligibility, giving rationale. Information sources 7 Describe all information sources (e.g., databases with dates of coverage, contact with study authors to identify additional studies) in the search and date last searched. Search 8 Present full electronic search strategy for at least one database, including any limits used, such that it could be repeated. Study selection 9 State the process for selecting studies (i.e., screening, eligibility, included in systematic review, and, if applicable, included in the meta-analysis). Data collection process 10 Describe method of data extraction from reports (e.g., piloted forms, independently, in duplicate) and any processes for obtaining and confirming data from investigators. Data items 11 List and define all variables for which data were sought (e.g., PICOS, funding sources) and any assumptions and simplifications made. Risk of bias in individual studies 12 Describe methods used for assessing risk of bias of individual studies (including specification of whether this was done at the study or outcome level), and how this information is to be used in any data synthesis. Summary measures 13 State the principal summary measures (e.g., risk ratio, difference in means). Synthesis of results 14 Describe the methods of handling data and combining results of studies, if done, including measures of consistency (e.g., I2) for each meta-analysis. Risk of bias across studies 15 Specify any assessment of risk of bias that may affect the cumulative evidence (e.g., publication bias, selective reporting within studies). Additional analyses 16 Describe methods of additional analyses (e.g., sensitivity or subgroup analyses, meta-regression), if done, indicating which were pre-specified. RESULTS Study selection 17 Give numbers of studies screened, assessed for eligibility, and included in the review, with reasons for exclusions at each stage, ideally with a flow diagram. Study characteristics 18 For each study, present characteristics for which data were extracted (e.g., study size, PICOS, follow-up period) and provide the citations. Risk of bias within studies 19 Present data on risk of bias of each study and, if available, any outcome-level assessment (see Item 12). Results of individual studies 20 For all outcomes considered (benefits or harms), present, for each study: (a) simple summary data for each intervention group and (b) effect estimates and confidence intervals, ideally with a forest plot. Synthesis of results 21 Present results of each meta-analysis done, including confidence intervals and measures of consistency. Risk of bias across studies 22 Present results of any assessment of risk of bias across studies (see Item 15). Additional analysis 23 Give results of additional analyses, if done (e.g., sensitivity or subgroup analyses, meta-regression [see Item 16]). DISCUSSION Summary of evidence 24 Summarize the main findings including the strength of evidence for each main outcome; consider their relevance to key groups (e.g., health care providers, users, and policy makers). Limitations 25 Discuss limitations at study and outcome level (e.g., risk of bias), and at review level (e.g., incomplete retrieval of identified research, reporting bias). Conclusions 26 Provide a general interpretation of the results in the context of other evidence, and implications for future research. FUNDING Funding 27 Describe sources of funding for the systematic review and other support (e.g., supply of data); role of funders for the systematic review. From QUOROM to PRISMA The new PRISMA checklist differs in several respects from the QUOROM checklist, and the substantive specific changes are highlighted in Table 2. Generally, the PRISMA checklist “decouples” several items present in the QUOROM checklist and, where applicable, several checklist items are linked to improve consistency across the systematic review report. 10.1371/journal.pmed.1000097.t002 Table 2 Substantive specific changes between the QUOROM checklist and the PRISMA checklist (a tick indicates the presence of the topic in QUOROM or PRISMA). Section/Topic Item QUOROM PRISMA Comment Abstract √ √ QUOROM and PRISMA ask authors to report an abstract. However, PRISMA is not specific about format. Introduction Objective √ This new item (4) addresses the explicit question the review addresses using the PICO reporting system (which describes the participants, interventions, comparisons, and outcome(s) of the systematic review), together with the specification of the type of study design (PICOS); the item is linked to Items 6, 11, and 18 of the checklist. Methods Protocol √ This new item (5) asks authors to report whether the review has a protocol and if so how it can be accessed. Methods Search √ √ Although reporting the search is present in both QUOROM and PRISMA checklists, PRISMA asks authors to provide a full description of at least one electronic search strategy (Item 8). Without such information it is impossible to repeat the authors' search. Methods Assessment of risk of bias in included studies √ √ Renamed from “quality assessment” in QUOROM. This item (12) is linked with reporting this information in the results (Item 19). The new concept of “outcome-level” assessment has been introduced. Methods Assessment of risk of bias across studies √ This new item (15) asks authors to describe any assessments of risk of bias in the review, such as selective reporting within the included studies. This item is linked with reporting this information in the results (Item 22). Discussion √ √ Although both QUOROM and PRISMA checklists address the discussion section, PRISMA devotes three items (24–26) to the discussion. In PRISMA the main types of limitations are explicitly stated and their discussion required. Funding √ This new item (27) asks authors to provide information on any sources of funding for the systematic review. The flow diagram has also been modified. Before including studies and providing reasons for excluding others, the review team must first search the literature. This search results in records. Once these records have been screened and eligibility criteria applied, a smaller number of articles will remain. The number of included articles might be smaller (or larger) than the number of studies, because articles may report on multiple studies and results from a particular study may be published in several articles. To capture this information, the PRISMA flow diagram now requests information on these phases of the review process. Endorsement The PRISMA Statement should replace the QUOROM Statement for those journals that have endorsed QUOROM. We hope that other journals will support PRISMA; they can do so by registering on the PRISMA Web site. To underscore to authors, and others, the importance of transparent reporting of systematic reviews, we encourage supporting journals to reference the PRISMA Statement and include the PRISMA Web address in their Instructions to Authors. We also invite editorial organizations to consider endorsing PRISMA and encourage authors to adhere to its principles. The PRISMA Explanation and Elaboration Paper In addition to the PRISMA Statement, a supporting Explanation and Elaboration document has been produced [18] following the style used for other reporting guidelines [19]–[21]. The process of completing this document included developing a large database of exemplars to highlight how best to report each checklist item, and identifying a comprehensive evidence base to support the inclusion of each checklist item. The Explanation and Elaboration document was completed after several face to face meetings and numerous iterations among several meeting participants, after which it was shared with the whole group for additional revisions and final approval. Finally, the group formed a dissemination subcommittee to help disseminate and implement PRISMA. Discussion The quality of reporting of systematic reviews is still not optimal [22]–[27]. In a recent review of 300 systematic reviews, few authors reported assessing possible publication bias [22], even though there is overwhelming evidence both for its existence [28] and its impact on the results of systematic reviews [29]. Even when the possibility of publication bias is assessed, there is no guarantee that systematic reviewers have assessed or interpreted it appropriately [30]. Although the absence of reporting such an assessment does not necessarily indicate that it was not done, reporting an assessment of possible publication bias is likely to be a marker of the thoroughness of the conduct of the systematic review. Several approaches have been developed to conduct systematic reviews on a broader array of questions. For example, systematic reviews are now conducted to investigate cost-effectiveness [31], diagnostic [32] or prognostic questions [33], genetic associations [34], and policy making [35]. The general concepts and topics covered by PRISMA are all relevant to any systematic review, not just those whose objective is to summarize the benefits and harms of a health care intervention. However, some modifications of the checklist items or flow diagram will be necessary in particular circumstances. For example, assessing the risk of bias is a key concept, but the items used to assess this in a diagnostic review are likely to focus on issues such as the spectrum of patients and the verification of disease status, which differ from reviews of interventions. The flow diagram will also need adjustments when reporting individual patient data meta-analysis [36]. We have developed an explanatory document [18] to increase the usefulness of PRISMA. For each checklist item, this document contains an example of good reporting, a rationale for its inclusion, and supporting evidence, including references, whenever possible. We believe this document will also serve as a useful resource for those teaching systematic review methodology. We encourage journals to include reference to the explanatory document in their Instructions to Authors. Like any evidence-based endeavor, PRISMA is a living document. To this end we invite readers to comment on the revised version, particularly the new checklist and flow diagram, through the PRISMA Web site. We will use such information to inform PRISMA's continued development. Supporting Information Figure S1 Flow of information through the different phases of a systematic review (downloadable template document for researchers to re-use). (0.08 MB DOC) Click here for additional data file. Text S1 Checklist of items to include when reporting a systematic review or meta-analysis (downloadable template document for researchers to re-use). (0.04 MB DOC) Click here for additional data file.
- Record: found
- Abstract: found
- Article: not found
The Aedes aegypti Toll Pathway Controls Dengue Virus Infection
Zhiyong Xi, JOSÉ RAMÍREZ, George Dimopoulos (2008)
Introduction The dengue viruses, whose geographic distribution resembles that of malaria, has become the most important arboviral pathogen in recent years because of its increasing incidence in the tropics and subtropics as well as its high morbidity and mortality. The public health impact of dengue is enormous, given that 2.5 billion people live in dengue-endemic areas and are at daily risk of infection [1]. The dengue viruses are single-stranded positive RNA belonging to the family Flaviviridae, genus Flavivirus. They are transmitted between humans primarily by the mosquito Ae. aegypti and by Ae. albopictus as a secondary vector [2]. The four closely related dengue serotypes are antigenically distinct, each comprising several genotypes that exhibit differences in their infection characteristics in both the mosquito vector and the human host [3],[4]. The extrinsic incubation period of dengue viruses in the mosquito is 7–14 days and is dependent on the mosquito strain, virus genotype, and environmental factors such as humidity and temperature [5],[6]. When the mosquito ingests a dengue-infected blood meal, the virus first infects the midgut tissue, within which it replicates to produce more virus particles. It then spreads through the hemolymph to other tissues such as the trachea, fat body, and salivary glands, where it is further propagated through replication. Peak virus titers usually occur between 7 and 10 days post-infection in the midgut and between 7 and 17 days in the abdomen. Peak levels in the head and salivary gland occur later, at about 12–18 days after feeding [7]. This extrinsic incubation time varies for different virus-vector combinations, and the tropism of the virus is dependent on the mosquito's tissue- and cell-specific susceptibility to different genotypes [5],[7]. In arthropods, innate immunity plays an important role in limiting pathogen infection, both through the production of effector molecules such as antimicrobial peptides and through phagocytosis and encapsulation, secretion of physical barriers, and melanization [8]. Studies that were mainly conducted in the insect model D. melanogaster have shown that arthropod immune responses are largely regulated by two main pathways, the Toll and immune deficiency (Imd) pathways [9],[10]. Activation of the Toll pathway by microbes through pattern recognition receptors (PRRs) leads to a cascade of events that result in the degradation of the negative regulator Cactus, translocation to the nucleus of transcription factors such as Dif, and a rapid increase in antimicrobial compounds and other effectors [10]–[12]. The Imd pathway is involved in the defense against Gram-negative bacteria, and upon activation it follows a cascade of events similar to those in the Toll pathway, involving putative degradation of its negative regulator Caspar, translocation of the transcription factor Relish to the nucleus, and the production of effectors and antimicrobial compounds [13],[14]. In contrast to the relatively well-characterized Toll and Imd pathways, less is known about the Janus kinase signal transducers and activators of transcription (JAK/STAT) pathway, which comprises multiple factors and has been linked to immune responses in the fruit fly [15],16. Comparative genomics analyses have shown a striking degree of conservation of these immune signaling pathways in D. melanogaster, Anopheles gambiae and Ae. aegypti; in contrast, the upstream pattern recognition receptors and the downstream effectors have differentiated quite significantly among the three species, probably as a result of different microbial exposures [17]. The Rel family transcription factors, Dif and Relish in Drosophila or their corresponding Rel1 and Rel2 in mosquitoes, can be studied through RNA interference (RNAi)-mediated silencing of the negative regulators Cactus and Caspar, respectively [11],[13],[14]. This approach allows a transient simulation, to at least a partial degree, of the Toll and Imd pathways in the absence of a microbial elicitor. The activation of these pathways can be monitored through the transcriptional activation of some of the signal cascade factors, such as the up-regulation of the Rel family transcription factors and down-regulation of the negative regulator Cactus or Caspar for the Toll or Imd pathway, respectively [11],[13],[14]. At present, relatively little is known about the anti-viral defense systems in insects. In D. melanogaster, the RNAi-mediated defenses appear to be key players in the defense against a broad range of viruses [18],[19], while some of the classical innate immune pathways such as the Toll and JAK-STAT pathways have also been implicated in limiting virus infection [20],[21]. Specifically, D. melanogaster has been shown to use its RNAi machinery and the Toll pathway to limit Drosophila×virus infection (a member of the Dicistroviridae) [19],[21], and it uses its RNAi machinery and the JAK-Stat pathway to limit Drosophila C virus infection (a member of the Birnavirus family) [20],[22]. Another study has demonstrated the involvement of the D. melanogaster RNAi machinery in the defense against two diverse animal viruses: a flock house virus and a cricket paralysis virus [18]. With all the above knowledge, however, the molecular mechanisms that govern their activation after infection and their role in virus clearance are unknown. Links between the RNAi machinery and the innate immune signaling pathways have yet not been identified [18],[23]. Similarly, limited knowledge on the antiviral response in mosquitoes is available. In Ae. aegypti, Sindbis virus (Alphavirus; Togaviridae) infection has been shown to induce the Toll pathway-related Rel1 transcription factor and three transcripts of the ubiquitin-ligase pathway genes, which are known regulators of NFkB-like proteins [24]. The RNAi machinery has also been linked to the anti-dengue defense in Ae. aegypti [25] and anti- O'nyong-nyong virus (Alphavirus; Togaviridae) in An. gambiae [26]. In addition, the O'nyong-nyong virus has been shown to induce 18 genes in A. gambiae, including a 70-kDa heat shock protein factor that later was shown to influence the virus's ability to propagate in the vector [27]. The recently available Ae. aegypti genome sequence [28], in combination with high-throughput gene expression and reverse genetic methodology, have provided unprecedented opportunities to study the mosquito's responses and defenses against dengue virus infection. Here, we report the global transcriptional response of Ae. aegypti to the infection of dengue virus serotype 2 (DENV-2), and show that DENV-2 induces a set of genes corresponding to the Toll and JAK-STAT pathways. Activation of the Toll and Imd pathways in Ae. aegypti through RNAi-mediated silencing of Cactus and Caspar caused a reduction in dengue virus infection level that appeared to be controlled primarily by the Toll pathway. Repression of the Toll pathway through MYD88 gene silencing resulted in higher dengue virus infection levels. We also present compelling evidence for an inhibitory effect of the mosquito's natural microbiota on virus infection and discuss the implications of these findings and the potential role of the mosquito's microbial exposure and innate immune system in modulating dengue virus transmission. Results Global transcriptome responses to dengue infection at 10 days after an infected blood meal We first assessed the physiological response of the Ae. aegypti mosquito to systemic dengue infection at the gene-specific level in the midgut and remaining carcass by using a genome-wide transcriptional profiling approach. A comparison of the transcript abundance in the two body compartments of mosquitoes that were fed 10 days earlier on dengue-infected blood or naïve blood revealed broad responses to virus infection that entailed a variety of physiological systems (Fig 1). The carcass displayed a significantly larger number of regulated genes (240 up-regulated and 192 down-regulated) than did the smaller midgut tissue (28 up-regulated and 35 down-regulated). The magnitude of the gene regulation, as measured by the -fold change in transcript abundance, was also greater in the carcass, suggesting that tissues in the carcass are at this stage of infection more actively engaged in the response to infection, while the midgut tissue may have reached a steady-state/balance in its interaction with the virus (Tables S1 and S2). A fairly large proportion (33.5%) of the genes displayed a similar expression profile in the midgut and the carcass (Tables 1, S1, and S2). The most striking infection-responsive gene regulation was observed for genes with putative functions related to the mosquito's innate immune system; these genes represented 34.5% in the midgut and 27.5% in the carcass of all the regulated genes with predicted functions (Fig. 1). Other major functional gene groups that were affected by virus infection included metabolism, oxidoreductive processes, and stress responsive systems, and are discussed in greater detail in Text S1. 10.1371/journal.ppat.1000098.g001 Figure 1 Functional classification of differentially expressed genes in the dengue-infected midgut and carcass at 10 days after blood meal. The graph shows the functional class distributions in real numbers of genes that are regulated by virus infection (+ indicate induced and – indicate repressed). The virus infection responsive gene expression data are presented in Tables S1 and S2. Functional group abbreviations: IMM, immunity; R/S/M, redox, stress and mitochondrion; CSR, chemosensory reception; DIG, blood and sugar food digestive; PRT, proteolysis; C/S, cytoskeletal and structural; TRP, transport; R/T/T, replication, transcription, and translation; MET, metabolism; DIV, diverse functions; UNK, unknown functions. 10.1371/journal.ppat.1000098.t001 Table 1 Differentially expressed putative immune genes in the dengue-infected midgut and carcass and their overlap with those of Cactus- and Caspar-silenced mosquitoes. Gene ID Gene Name No Function group Logfold Carcass Midgut dsCact dsCaspar AAEL000709 CACT 62 Toll −0.842 −0.084 0.515 0.074 AAEL007696 REL1A 64 Toll 0.924 −0.096 1.005 0.157 AAEL001929 SPZ5 63 Toll 1.61 0.037 0.034 0.106 AAEL003507 TOLL1B 66 Toll 0.947 0.014 0.08 AAEL013441 TOLL9A 65 Toll 1.189 −0.036 −0.054 0.149 AAEL004223 CECB 5 Effector 0.544 0.81 −0.148 0.61 AAEL015515 CECG 6 Effector 1.052 0.131 1.394 −2.992 AAEL003832 DEFC 9 Effecttor −1.81 0.143 0.95 −1.665 AAEL003857 DEFD 8 Effector −0.127 1.076 0.999 −1.962 AAEL003849 DEFE 7 Effector 0.824 0.053 −0.811 1.697 AAEL004522 GAM 10 Effector 0.851 1.118 −1.406 0.85 AAEL015404 LYSC 11 Effector 1.007 0.935 1.105 0.082 AAEL006702 FREP 31 Pattern Recognition Receptor 1.143 0.031 −0.333 −0.009 AAEL006699 FREP 32 Pattern Recognition Receptor −1.129 −1.297 0.016 AAEL006704 FREP 33 Pattern Recognition Receptor 0.073 −0.896 −1.128 0.313 AAEL000652 GNBPA2 28 Pattern Recognition Receptor 0.805 0.928 0.041 −0.025 AAEL009178 GNBPB4 30 Pattern Recognition Receptor 0.92 −0.126 −0.065 0.061 AAEL007064 GNBPB6 29 Pattern Recognition Receptor 0.886 0.088 0.118 −1.077 AAEL003325 ML 34 Pattern Recognition Receptor −0.949 0.85 0.05 0.083 AAEL009531 ML 35 Pattern Recognition Receptor 1.427 −0.072 0.031 −0.83 AAEL006854 ML 36 Pattern Recognition Receptor 0.031 1.143 0.263 0.219 AAEL014989 PGPPLD, putative 38 Pattern Recognition Receptor 2.11 0.101 −0.155 −0.113 AAEL011608 PGRPLD 37 Pattern Recognition Receptor 1.962 0.011 −0.098 −0.099 AAEL012267 TEP13 41 Pattern Recognition Receptor 1.325 0.084 0.112 0.8 AAEL014755 TEP15 42 Pattern Recognition Receptor 1.19 −0.023 1.628 0.168 AAEL001794 TEP20 40 Pattern Recognition Receptor 0.896 0.191 1.518 0.313 AAEL000087 TEP22 39 Pattern Recognition Receptor 1.819 0.084 1.896 0.317 Aaeg:N19306 TEP24 44 Pattern Recognition Receptor 0.8943 Aaeg:N18111 TEP25 43 Pattern Recognition Receptor 1.2427 AAEL003253 CLIPB13B 45 Signal Modulation 1.038 0.209 1.638 0.003 AAEL005093 CLIPB46 48 Signal Modulation −0.913 1.121 0.344 AAEL005064 CLIPB5 46 Signal Modulation −0.852 0.059 1.548 0.315 AAEL007593 CLIPC2 47 Signal Modulation −0.815 0.15 1.379 0.155 AAEL014390 CTL 52 Signal Modulation 0.986 0.162 0.942 0.188 AAEL003119 CTL6 49 Signal Modulation 0.85 0.018 0.12 −0.009 AAEL011619 CTLGA8 51 Signal Modulation 0.986 0.085 1.129 0.281 AAEL011455 CTLMA12 50 Signal Modulation 1.095 0.134 2.473 0.216 AAEL000256 SCRB9 53 Signal Modulation 1.036 0.203 0.223 0.023 AAEL014079 SRPN1 59 Signal Modulation 0.915 −0.017 0.995 −0.027 AAEL007765 SRPN10A 61 Signal Modulation 0.166 −0.963 0.841 −0.009 AAEL014078 SRPN2 58 Signal Modulation 0.884 −0.048 −2.026 AAEL002730 SRPN21 54 Signal Modulation 1.426 0.128 0.41 0.148 AAEL002715 SRPN22 60 Signal Modulation 0.12 1.244 0.062 0.166 AAEL013936 SRPN4A 57 Signal Modulation 1.35 0.041 1.426 0.156 AAEL013934 SRPN4D 56 Signal Modulation 1.343 0.217 0.91 0.259 AAEL008364 SRPN9 55 Signal Modulation −0.951 −0.031 1.275 0.169 AAEL000393 Suppressors of cytokine signalling 13 JAK-STAT 0.909 0.058 0.186 0.103 AAEL009645 Hypothetical protein 14 JAK-STAT −0.846 −0.584 0.427 −0.012 AAEL009822 Metabotropic glutamate receptor 15 JAK-STAT 1.405 0.185 −0.086 0.028 AAEL012471 DOME 16 JAK-STAT 1.078 −0.06 1.561 −0.868 AAEL012510 IKK2 12 Imd −0.912 −1.042 0.043 −0.034 AAEL003439 CASPS18 1 Apoptosis 0.803 0.017 −0.821 −0.094 AAEL012143 CASPS7 2 Apoptosis −0.854 0.014 −0.068 −0.034 AAEL011562 CASPL2 3 Apoptosis −0.606 −0.839 0.183 0.076 AAEL014658 CASPS20 4 Apoptosis −0.898 −0.064 0.019 Aaeg:N41501 CAT1A 17 Oxidative defense enzymes −0.84617 AAEL004386 HPX8C 18 Oxidative defense enzymes −1.106 −0.031 −1.745 0.049 AAEL004388 HPX8A 19 Oxidative defense enzymes −1.685 0.047 −2.054 0.094 AAEL004390 HPX8B 20 Oxidative defense enzymes −1.034 0.063 −1.357 0.268 AAEL000274 CuSOD3, putative 21 Oxidative defense enzymes −0.911 −0.119 −1.184 0.078 AAEL006271 CuSOD2 22 Oxidative defense enzymes −0.841 −0.006 −1.099 −0.001 AAEL009436 SOD-Cu-Zn 23 Oxidative defense enzymes −0.955 −0.473 0.173 0.148 AAEL011498 CuSOD3 24 Oxidative defense enzymes −0.9 −0.16 −1.205 0.079 AAEL004112 TPX2 25 Oxidative defense enzymes −1.433 −0.265 −0.84 0.06 AAEL014548 TPX3 26 Oxidative defense enzymes −0.893 0.021 −0.17 −0.041 AAEL002309 TPX4 27 Oxidative defense enzymes −0.301 −1.486 0.13 0.153 Dengue-infected midguts and carcasses were dissected and collected from the mosquitoes at 10 day after the blood meal. Injection of dsRNA of Cactus and Caspar into mosquitoes was conducted at 2 days post-emergence, and samples were collected for microarray analysis at 4 days after injection. Immune responses to dengue infection The 53 and 18 putative immune genes that were regulated by virus infection in the carcass and midgut tissues, respectively, were associated with a variety of immune functions such as PRRs, signaling modulation and transduction, effector systems, and apoptosis (Table 1). The functional group representations of the infection-responsive genes and their direction of regulation in the carcass and midgut tissues were quite similar, suggesting that the anti-viral responses involved the same types of defense mechanisms in these two compartments. For example, specific genes that displayed a similar pattern of regulation were lysozyme C (LYSC, AAEL015404), gambicin (AAEL004522), Ikkg (AAEL012510) and the Gram-negative binding protein A2 (GNBPA2, AAEL000652). A closer investigation of immune gene regulation using in silico comparative genomics analysis [17] revealed a striking bias toward genes putatively linked with the Toll immune signaling pathway (Fig. 2) as well as the JAK-STAT pathway. Activation of the Toll pathway in the carcass was supported by the up-regulation of Spaetzle (Spz), Toll, and Rel1A, and the down-regulation of the negative regulator Cactus. Three members of the Gram-negative bacteria-binding protein (GNBP) family were up-regulated, together with a clip-domain serine protease (CLIP), while the other two CLIPs were down-regulated; several antimicrobial effector molecules were up-regulated, including the defensins (DEFs), cecropins (CECs) and a lysozyme (LYSC). Only one predicted gene of the Imd immune signaling pathway, Ikkg, was down-regulated. One of the key components of the JAK-STAT pathway, Domeless (Dome), was induced upon dengue virus infection as well as three other genes (AAEL009645, AAEL009822 and AAEL000393) which have JAK-STAT pathway related orthologs in D. melanogaster [29]. Six members of the thio-ester containing protein (TEPs) gene family were also regulated by dengue infection, while TEP1 has been demonstrated to be a down-stream effector molecule of JAK-STAT pathway in D. melanogaster [30]. 10.1371/journal.ppat.1000098.g002 Figure 2 Regulation of putative Toll signaling pathway genes by dengue virus infection. Red color indicates infection responsive up-regulation and green color indicate infection responsive down-regulation. Non-colored gene boxes indicate lack of infection responsive regulation. The pathway was built with GenMapp software based on the immunogenomics prediction by Waterhouse et al 2007. To establish further evidence that dengue infection activates the Toll immune signaling pathway, we designed experiments to assess the relationships between dengue infection-responsive gene regulation and Rel1- and Rel2-controlled gene regulation. Previous studies in D. melanogaster and An. gambiae have shown that the Rel1 and Rel2 transcription factors can be activated by depleting their negative regulators Cactus and Caspar, respectively [13],[14],[31]. To confirm that the Toll and Imd pathway had been activated, we depleted Cactus and Caspar using RNAi silencing and assayed the expression of the antimicrobial peptide genes DEF and CEC in gene-silenced mosquitoes and non-silenced controls (Fig. 3A). Gene silencing of either Cactus or Caspar induced the expression of these two genes. To link this activation to the Rel1 and Rel2 transcription factors, we performed double-knockdown assays in which both Cactus and Rel1 or Caspar and Rel2 were targeted simultaneously with RNAi and compared the effect of this double silencing on antimicrobial peptide gene expression to that of silencing the negative regulators alone. The double-knockdown treatments either compromised (in the case of Cactus and Rel1) or completely reversed (in the case of Caspar and Rel2) the effect induced by single-knockdown of Cactus or Caspar, respectively, indicating that these negative regulators could be used to activate these two transcription factors (Fig. 3A). The quantitative differences in the levels of de-activation of the Rel1- and Rel2-controlled transcription that were produced with this double-knockdown approach most likely reflect differences in the efficiency and kinetics of the RNAi-mediated depletion of different proteins. 10.1371/journal.ppat.1000098.g003 Figure 3 Comparative analysis of the dengue virus infection-responsive and Rel1 and Rel2 regulated transcriptomes. A. Expression analysis of defensin (DEF), cecropin (CEC), Cactus (CAC), and Rel1 in Cactus, and Cactus and Rel1 depleted mosquitoes (upper panel) and in Caspar, and Caspar and Rel2 depleted mosquitoes. Bar represents standard error. B. Venn diagram showing uniquely and commonly regulated genes in dengue infected and Cactus and Caspar depleted mosquitoes. C. Cluster analysis of 131 genes that were regulated in at least two of four treatments: dengue-infected midgut and carcass, and whole mosquitoes upon Cactus (CAC(-)) or Caspar (CSP(-)) depletion. The expression data of immune genes, indicated by the number beside the panel are presented in Table 1, and all genes presented in the hierarchical cluster matrix are listed in Table S6. The primary data for the real-time qPCR assays are presented in Table S3. We then determined the gene repertoires that were regulated by the Rel1 and Rel2 transcription factors, using a microarray-based approach in which we compared the transcript abundance in the Cactus and Caspar gene-silenced mosquitoes to that in GFP dsRNA-treated control mosquitoes. Our results indicated that differential gene regulation in the Cactus-depleted mosquitoes showed a strong bias toward the Toll pathway. For instance, we observed the up-regulation of Rel1 (AAEL007696), multiple Toll receptors (AAEL007619, AAEL000057, AAEL007613), Spätzle ligands (AAEL013434, AAEL008596), Gram-negative binding proteins (AAEL007626 and AAEL003889), and the antimicrobial peptides DEFD, CECA, D, E & G (AAEL003857, AAEL000627, AAEL000598, AAEL000611, AAEL015515). In total, Cactus gene silencing resulted in the up-regulation of 460 and down-regulation of 1423 genes belonging to different functional classes, with a predominant representation by immune genes (13.7% of all genes with predicted functions). The regulation of a variety of other functional gene groups by Rel1 is indicative of the multiple functional roles of the Toll pathway, including its contributions to immunity and development [32]. Differential gene regulation in Caspar-depleted mosquitoes was much less pronounced, with only 35 genes being induced and 137 being repressed. Those induced by Caspar silencing included TEP13 and the antimicrobial peptides DEFE and gambicin (AAEL004522 and AAEL003849). Rel1 and Rel2 are most likely regulating additional genes that were not detected because of the limited sensitivity of microarray-based gene expression assays. A comparison of the dengue infection-responsive gene repertoire to that of Cactus gene-silenced mosquitoes showed a significant overlap, with 41% (18 of 44) of the immune genes being up-regulated by both the virus infection and Cactus gene silencing (Fig. 3B). In contrast, only 9% (4 of 44) of the dengue-regulated immune genes were also regulated in Caspar gene-silenced mosquitoes (Fig. 3B). Hierarchical clustering of genes that were differentially expressed in at least two of the three situations (Cactus silencing, Caspar silencing, and dengue infection) revealed a close relationship between Cactus silencing- and dengue infection-related regulation (Fig. 3C). In particular, expression cluster V, which is highly enriched with immune genes, was affected by both the Cactus silencing and dengue infection treatments. Differential gene expression in Cactus-silenced and dengue-infected mosquitoes showed a strong correlation with regard to both the direction and magnitude of the regulation of this expression cluster (Fig. 3C, Cluster V). Further dissection of the expression cluster V defined three main groups: Toll pathway-, JAK-STAT pathway-, and signal modulation- related genes. The signal modulation cascade genes included four C-type lectins (CTLs) and six serine protease inhibitors (SRPNs). A plausible hypothesis is that both the Toll and JAK-STAT pathways may be regulated at least in part by the same signal modulation cascade that includes serine proteases and serpins. Consistent to this hypothesis, evidences suggest that the JAK-STAT pathway could be indirectly activated by the Toll cascade in D. melanogaster [30]. Interestingly, genes in this cluster showed similar regulation for the midgut and carcass and for Cactus-silenced mosquitoes, although the magnitude of the regulation was smaller in the midgut, further supporting the notion of a similar type of antiviral defense in the gut and carcass tissues. Expression cluster III was characterized by a repression of seven oxidative defense enzyme genes in both Cactus-silenced and dengue-infected mosquitoes (Fig3C, Cluster III). The genes that showed different profiles for Cactus silencing and dengue infection are listed in the remaining clusters (Fig 3C, Cluster I, II and IV). Several putative apoptotic genes, such as caspases, were also regulated by dengue infection. Similar results have also been observed in D. melanogaster in response to Drosophila C virus infection [20], suggesting a potential connection between virus infection and apoptosis. The Toll pathway is involved in the anti-dengue defense The prominent activation of the Toll pathway (Rel1)-regulated genes in response to dengue infection strongly suggested that this pathway is involved in the mosquito's anti-dengue defense. To investigate this hypothesis, we tested the effect of both Cactus and Caspar gene silencing on virus infection in the midgut and carcass at 7 days after an infectious blood meal. This cactus gene silencing reduced the extent of dengue infection in the midgut by 4.0-fold (P 0.05, the inconsistent replicates (with distance to the median of replicate ratios large than 0.8) were removed, and only the value from a gene with at least two replicates were further averaged. Toll and Imd signaling pathways were built on the basis of a recent bioinformatics prediction [17] with GeneMAPP2 software [39]. The latter was also used for the generation of the expression datasets. The gene database was created with the Ae. aegypti gene ontology by the GeneMapp development team. Three independent biological replicate assays were performed. Numeric microarray gene expression data are presented in Tables S1 and S2. Real-time qPCR assays Real-time qPCR assays were conducted as previous described [37]. Briefly, RNA samples were treated with Turbo DNase (Ambion, Austin, Texas, United States) and reverse-transcribed using Superscript III (Invitrogen, Carlsbad, California, United States) with random hexamers. Real-time quantification was performed using the QuantiTect SYBR Green PCR Kit (Qiagen) and ABI Detection System ABI Prism 7000 (Applied Biosystems, Foster City, California, United States). Three independent biological replicates were conducted and all PCR reactions were performed in triplicate. The ribosomal protein S7 gene was used for normalization of cDNA templates. Primer sequences are listed in Table S5. Numeric data for the real-time qPCR assays are presented in Table S3. Gene-silencing assays RNA interference (RNAi)-based gene-silencing assays were conducted according to standard methodology [34]: Approximately 69 ηl dsRNAs (3 µg/µl) in water was injected into the thorax of cold-anesthetized 4-day-old female mosquitoes using a nano-injector as previously described (http://www.jove.com/index/Details.stp?ID=230). Three to four days after injection and validation of gene-specific silencing, mosquitoes were fed on a DENV-2-supplemented blood meal. Dissection of mosquito midguts, thoraxes, and heads were done on the seventh day PBM. Each tissue was homogenized separately in the same medium as used for C6/36 cells (MEM) and used for virus titration. Three independent biological replicate assays were performed for each gene. The following primers were used for the synthesis of Cactus, Caspar and MyD88 dsRNA using the T7 megascript kit (Ambion): Cactus_F: TAATACGACTCACTATAGGG CGAGTCAACAGAACCCGAGCAG, Cactus_R: TAATACGACTCACTATAGGG TGGCCCGTCAGCACCGAAAG, Caspar_F: TAATACGACTCACTATAGGG GGAAGCAGATCGAGCCAAGCAG, Caspar_R: TAATACGACTCACTATAGGG GCATTGAGCCGCCTGGTGTC, MyD88_F: TAATACGACTCACTATAGGGGGCGATTGGTGGTTGTTATT, MyD88_R: TAATACGACTCACTATAGGGTTGAGCGCATTGCTAACATC, DENV-2 virus titration Virus titers in the tissue homogenates were measured as previously reported (http://www.jove.com/index/Details.stp?ID=220): The virus-containing homogenates were serially diluted and inoculated into C6/36 cells in 24-well plates. After incubation for 5 days at 32°C and 5% CO2, the plates were assayed for plaque formation by peroxidase immunostaining, using mouse hyperimmune ascitic fluid (MHIAF, specific for DENV-2) and a goat anti-mouse HRP conjugate as the primary and secondary antibody, respectively. Numeric PFU data are presented in Table S3. Mosquito antibiotic treatment After pupation, mosquitoes were transferred to a sterile cage and provided a sterile 10% sucrose solution with 15 mg/ml gentamicin, 10 units penicillin, and 10 µg streptomycin as a sugar source. The removal of microbes was confirmed by colony-forming unit assays prior to blood-feeding and after a surface sterilization that involved vortexing in 70% ethanol and subsequent rinsing in double-distilled sterile H2O. Each entire mosquito was then homogenized in 100 µl autoclaved PBS and plated on LB-agar, and the plates were checked for presence of bacterial growth at 48 h post-inoculation. Indirect immunofluorescence assays These assays were performed according to a modification of a previously established method [40]. The midguts from 7-day-old mosquitoes were dissected in 1.0% paraformaldehyde in PBS. After a 1-h incubation in 50 µl of 4.0% paraformaldehyde in a 96-well plate, the midguts were washed three times with 100 µl PBS for 1 min each; 100 µl of 10% goat serum was then added to the antibody dilution buffer (0.1% TritonX-100 and 0.2% BSA in PBS) and incubated overnight. The midguts were then incubated with FITC-conjugated monoclonal antibody 2H2 at 37°C for 1 h. The midguts were washed twice with PBS at room temperature for 1 h and then stained with Evans blue counter-stain (diluted 1: 100), placed onto slides, and covered with Bartel B 1029-45B mounting medium and a coverslip. Preparations were examined under a Nikon fluorescence microscope. Accession numbers The Entrez Gene ID for genes and proteins mentioned in the text are 5565922 (Cactus), 5569526 (REL1A), 5578608 (Caspar), 5569427 (REL2), 5579094 (DEF), 5579377 (CEC), 5578028 (Attacin), 5565542 (Diptericin), 5579192 (GNBPB1), 5564897 (PGRGLC), 5564993 (Gambicin), 5569574 (MyD88), 5579458 (LYSC), 5576410 (Ikkg), 5565422 (GNBPA2), 5580019 (AAEL009645), 5572476 (AAEL009822), 5576330 (AAEL000393), 5576380 (DOME), 5573010 (SPZ5), 5578273 (TOLL1B), 5577966 (TOLL9A), 5576030 (TEP13), 5565197 (TEP15), 5572428 (TEP20). 5563609 (TEP22), 5568254 (FREP), 5577659 (CLIPB13B). Supporting Information Figure S1 A. The bacteria flora in the mosquito lumen does not influence the viability of the dengue virus. Seven days old antibiotic treated aseptic or non-treated septic mosquitoes were fed with the same mixture of DENV-2 and blood. Two hour after the blood meal, midguts were dissected and their content was immediately diluted with 100 ul sterile PBS. Three replicates of five guts each were collected. After a brief homogenization and centrifugation, the supernatants were used to determine the virus titer with the standard plaque assay. B. In vitro exposure of dengue virus to midgut bacteria does not affect the virus viability. Incubation of the dengue virus with either sterile PBS, bacteria exposed supernatant or a bacteria suspension did not result in any significant difference in virus viability. Ten midguts from seven days old septic female mosquitoes were dissected and homogenized in 100 ul sterile PBS prior to plating on a LB agar plate for bacterial growth. Bacteria colonies were washed off the plate with PBS and collected into a 1.5 ml tube. After a 10 minutes centrifugation at 1,500 g the bacteria-free supernatant and the bacteria pellet were collected. The bacteria pellet was re-suspended into PBS to get the bacteria solution. Then, equal amount of virus were incubated for 3 hrs at room temperature with the bacteria, the bacteria free supernatant and the sterile PBS prior to titer determination with plaques assay. Three replicates were performed for each treatment. (0.07 MB JPG) Click here for additional data file. Table S1 The functional groups of the total 432 genes that were regulated by DENV-2 infection in the mosquito carcass at ten days after an infected blood meal, compared to that of non-infected blood fed control mosquitoes. Functional group abbreviations: IMM, immunity; RED/STE, redox and oxidoreductive stress; CSR, chemosensory reception; DIG, blood and sugar food digestive; PROT, proteolysis; CYT/STR, cytoskeletal and structural; TRP, transport; R/T/T, replication, transcription, and translation; MET, metabolism; DIV, diverse functions; UNK, unknown functions. (0.38 MB DOC) Click here for additional data file. Table S2 The functional groups of the total 63 genes that were regulated by DENV-2 infection in the mosquito midgut at ten days after an infected blood meal, compared to that of non-infected blood fed control mosquitoes. Functional group abbreviations: IMM, immunity; RED/STE, redox and oxidoreductive stress; CSR, chemosensory reception; DIG, blood and sugar food digestive; PROT, proteolysis; CYT/STR, cytoskeletal and structural; TRP, transport; R/T/T, replication, transcription, and translation; MET, metabolism; DIV, diverse functions; UNK, unknown functions. (0.08 MB DOC) Click here for additional data file. Table S3 Averaged data from three biological replicate real time qPCR assays of the expression of defensin, cecropin, Cactus, and Rel1in Cactus, and Cactus & Rel1 depleted mosquitoes (A) and in Caspar, and Caspar & Rel2 depleted mosquitoes (B). C. Fold change in the expression of selected immune genes in aseptic mosquitoes compared to septic mosquitoes. S.E., standard error. (0.06 MB DOC) Click here for additional data file. Table S4 A. Averaged data from three independent biological replicate plaque assays of the virus titer in the midguts of the Cactus, Caspar, MYD88 and GFP dsRNA treated mosquitoes. B. Results from three independent biological replicate plaque assays of the virus titer in the midgut of antibiotic treated aseptic and non-treated septic mosquitoes. S.E., standard error; S, significant; NS, Non-significant. (0.04 MB DOC) Click here for additional data file. Table S5 The prime sequences used for the real-time qPCR assays. (0.04 MB DOC) Click here for additional data file. Table S6 The expression data of all the genes that are shown in the hierarchical cluster matrix (Fig. 3C). (0.30 MB DOC) Click here for additional data file. Text S1 This section refers to other dengue infection responsive genes. (0.05 MB DOC) Click here for additional data file.
- Record: found
- Abstract: found
- Article: not found
Two Chikungunya Isolates from the Outbreak of La Reunion (Indian Ocean) Exhibit Different Patterns of Infection in the Mosquito, Aedes albopictus
Marie Vazeille, Sara Moutailler, Daniel Coudrier … (2007)
Background A Chikungunya (CHIK) outbreak hit La Réunion Island in 2005–2006. The implicated vector was Aedes albopictus. Here, we present the first study on the susceptibility of Ae. albopictus populations to sympatric CHIKV isolates from La Réunion Island and compare it to other virus/vector combinations. Methodology and Findings We orally infected 8 Ae. albopictus collections from La Réunion and 3 from Mayotte collected in March 2006 with two Chikungunya virus (CHIKV) from La Réunion: (i) strain 05.115 collected in June 2005 with an Alanine at the position 226 of the glycoprotein E1 and (ii) strain 06.21 collected in November 2005 with a substitution A226V. Two other CHIKV isolates and four additional mosquito strains/species were also tested. The viral titer of the infectious blood-meal was 107 plaque forming units (pfu)/mL. Dissemination rates were assessed by immunofluorescent staining on head squashes of surviving females 14 days after infection. Rates were at least two times higher with CHIKV 06.21 compared to CHIKV 05.115. In addition, 10 individuals were analyzed every day by quantitative RT-PCR. Viral RNA was quantified on (i) whole females and (ii) midguts and salivary glands of infected females. When comparing profiles, CHIKV 06.21 produced nearly 2 log more viral RNA copies than CHIKV 05.115. Furthermore, females infected with CHIKV 05.115 could be divided in two categories: weakly susceptible or strongly susceptible, comparable to those infected by CHIKV 06.21. Histological analysis detected the presence of CHIKV in salivary glands two days after infection. In addition, Ae. albopictus from La Réunion was as efficient vector as Ae. aegypti and Ae. albopictus from Vietnam when infected with the CHIKV 06.21. Conclusions Our findings support the hypothesis that the CHIK outbreak in La Réunion Island was due to a highly competent vector Ae. albopictus which allowed an efficient replication and dissemination of CHIKV 06.21.
Author and article information
Contributors
Ferdinand Nanfack-Minkeu: fnanfackminkeu@yahoo.com
Journal
Journal ID (nlm-ta): Virusdisease
Journal ID (iso-abbrev): Virusdisease
Title:
VirusDisease
Publisher:
Springer India
(New Delhi
)
ISSN
(Print):
2347-3584
ISSN
(Electronic):
2347-3517
Publication date
(Electronic):
18
October
2022
Pages: 1-12
Affiliations
[1
]GRID grid.419367.e, International Institute of Tropical Agriculture (IITA), ; 08 Tri-Postal, P.O. Box 0932, Cotonou, Benin
[2
]GRID grid.29273.3d, ISNI 0000 0001 2288 3199, Department Microbiology and Parasitology, Faculty of Science, , University of Buea, ; P.O. BOX 63, Buea, Cameroon
Author information
Sandra Ateutchia Ngouanet
http://orcid.org/0000-0002-5994-0406
Article
Publisher ID: 795DOI: 10.1007/s13337-022-00795-7
PMC ID: 9579656
SO-VID: 4d421f40-5b16-4b3c-bee1-aaff5bd5cb64
Copyright © © The Author(s), under exclusive licence to Indian Virological Society 2022, Springer
Nature or its licensor holds exclusive rights to this article under a publishing agreement
with the author(s) or other rightsholder(s); author self-archiving of the accepted
manuscript version of this article is solely governed by the terms of such publishing
agreement and applicable law.
License:
This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.
History
Date
received
: 9
May
2022
Date
accepted
: 19
September
2022
Categories
Subject:
Review Article
Data availability: